Otolemur_garnettii Locus Mono:236:SNORA19
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:236:SNORA19
Otolemur_garnettii
Mono:236:SNORA19
scaffold_81453
SNORA19
1001..1125
2125
TATAGCTCTTCTTTCAAATGATGCCTTACTCTTAACTTGCCCTTACTGTTTTTCCAACA
GTTCAGGAACAGACCTGTCACCACCACCACCCCTCCCCCCTTTTTATTTTTAGAGACAGA
ATCTCATTTTGTCACCATTGGTAGAGTGCTGTGGCATCACAGCTCACAGCAACCTCCAGC
TCTTGGGTTTAGGCTATTCTCTTGCCTCAGCCTCCCAAGTACCTGGGATTATTGGTGCCC
ATCACAACGTCCGGCTATTTTTTCTGCACTTTGGCCAGAGCCAGGTCTGAACTCGCCACC
CTCAGTATATGGGGCCGGCGCCTACTCACTGAGCAACAGGCGCCGCCCAAACCTGGCAAA
CCCTTACACCAGTCTTTCAAACTCCGGCCACACTAACTACTCAGTCTGATGCTGGTAATC
CAACATCTTGATCATATAAAGGAACTTGAATTTATTTTTATTTCTGCTAATATGAGTGCC
TGGTGAAACCAATCCGGAAAAGAGACATGTCATGTAGTATCCACAGCCAAAAAAGAAAAA
ACACGCTGCTTCACTAGATAAAAAGACAACTGAATATAGAAAAACTGTGAAAAGTCAAGA
ACTATCTTTGCTCAGAGACACATGACAACCAGATGTGTGAAAGTGCCAGTGAAGAGGAGA
AGACACAGCAAACTCCAGGCTGGAAGGTCCCAAGTTCTACCCTGACTCTGTCTATAACTC
TGCTCTTTTTATCTTGTGAGGTAATAAAGTATACAGATGGTTCCCACCCCAATGCTCAAG
ATGCTATGGACTTGGTTGTCTGACACCTTCTGTTACCAAGTACTCCACTTTAAATGCCAG
TCAAATTACAAACTTGGGCTATTTTTGTTCACAAGGTAGTACCTTATAAACATACAAAAC
ACACCATTCTAAGAAATCCCCTTCTAGATAATAATTCAAAGTTCTTTCGAATGATCAAAA
TACTTTCCCCAACATTTGGAACTTAAAAAATTGAAAGAGCAGAGCACATTTCATTGACCT
GCTTTCTATGTGAGCAGTGTTATTTCTCACGTGCTATACAAATAGTTGAAGGTTAATTAG
CAGTATCACTATAAATAGTAATGCTGCCAGTCTCCTTCAGACAAGAAATTTTATAAAAAG
TGGTTAAATGTATTAGGTAAATAACAGGTCTTTATCTACAAAGATGTGACCATTTAAGGT
TTTTTGTCTTGGGAAACTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved