Otolemur_garnettii Locus Mono:23:SNORA26
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:23:SNORA26
Otolemur_garnettii
Mono:23:SNORA26
scaffold_2889
SNORA26
1001..1123
2100
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGGCAGAAAGGGAA
ATTTCCGTACTCGGGACTAAATATGCAAAACAGCCTCTTAACGGGTTTTCGCGGTCTCCT
CACACTACTGAGATTCATGAGGTATTGGCCAGAGAAAGAAAAGACTGATGAAAAAAAATA
GCACGCCTACTAAAAAAAAAATCCCAAGTCGCCCTTTTCCTGTGGCCTTTTAAGGTTGAT
GCAGTGCTTTAAGAGGCTAACACAGAAGGGTAAAGTAAATCTCCATAAAACCCAGAGAAG
AGATTTTTGAAACTCCTCTTTGGATCCTGTCTGGAGTCACAGCTGAACTAGAAAATGATT
CATTACCATTTAAGCATCTTTGTGATTTTTTTAAAATACAGTTAATAGAACAAGAGATAC
ATGAAAGTTTTCTTGGTTTAAAGGTCGTTTTGAAACTTTTCTCCCCCTTCTTTTAATAGG
TCGAAAACTACAGGCACAAGCTATGGAAGCTGGGATGCTCTGGTGTTGGTATTTCCCCTG
ACTTAAACCCACTGTCACTCTGTATAGTTACAATAAGAAAGTGCAATAAGCTCTTTAAAT
ACGGAGGGTGCCAAAAAGATGTATGCGTATTTTAAGAGATGTAATCTAGATAGTATTTGG
CCTTCTCAGTCGCCAATTACGAATGTAATTACAGTAGCAACGTGTAGTATGACATTAGCT
TAAACTATGGTGCTGATCAAGTGATTGCCGGCGCCAGTCACCATGCGACAGGCAGGACAG
TCCAAGAAAATGGCGGAGTCGCGGTTGTCGTTTGAGGAGCGCAAGACCATTTTGAAGTGG
TATTTGAAATTCGAGAACATTGTGGAAGTGCAGCGACAGTGGAGGCGTGAGTACGCAACA
GACCCCCCAACACGCCTGACAATTGCGCGCATTCGTGATAAGTTTGAGACGCACGGTACC
GTGTGCGACGTGCACAAGGGCAGGTCCGGGAGGCCTCGCACGGCCACAAGCCCCGCTGTG
TCCGCGATGGTGTTGGAGCAGTTCACGCGCTCTCCGCAGAAGTCCACCAAGCAGTGTGCG
CGTGAGACCGGGATCAGCAGGACCAGCATACGGCGCATTCTTAAGACAGCAAAGTGGGAA
GTTTTTGTCCCGAGATTGTTACATTCCCTGAATGAAGACGACCCTGATCGAAGGGTTCAA
TACTGTGAGTGGTTCCAAAACATGGTACAAGTGGATGAGGAGTTTGTGGGGAAAATGGTT
TGGTCTGATGAAGCACAGTTTAAAGCTAAACGGAACAGTCAACCGACATAATTGCGTGTA
T
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved