Otolemur_garnettii Locus Mono:454:SNORD28
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:454:SNORD28
Otolemur_garnettii
Mono:454:SNORD28
GeneScaffold_5254
SNORD28
1001..1075
2075
GCTGTGCATTTTCATAGAAAATACCCTCAATTTATCATCAAGTTCCTAGAGAAGCAATT
AATAAATGTTATTAAAGCATAGGGTGGCATAGAGTTTCAAAATGATGATTACCATCTCTA
CCATATGAAACAGTTATTAATTCTAACCATTCACAGACTTGCAAGATGCGGCTAGTACAG
TATTATCTTTCCTATATGCTGACTATAAACGCATACAAGAAATAAAATAAATCACATGGC
ACAATAGCAGTCAACTTGTATATCTCTTTGTTTAAAATTCTGGAATGCACCAAGAGTGAT
TTAAGTAACTTATCTCTAAAAAAAGAAATTCTGTATCTCCCATGACAACATATTGGAGAA
CAGGGAGGAAAGTCTATGCACATTTGTTTCTCCACTCCCTGCCCACTACCAGCTTACCTA
TAGCCAGCAGAGCATCTTCAAAGCTACCAGATGTTTCAGATTTAATACTCTGTTCAATAT
CCTTCTGTGACATCCTTTTGTATTCATCAAACACTACACATAATAACAAAATGGTATTAT
CAATAATTAAAAAAGAATAGAGGAAACTAAAATTTATGACGAGAACAAGCATTTTTTAAA
TTAGTCTGCAATATTTATTCTTTGGCCTATTTCAAGAAGAAACTAATCAGCAATGTGGGA
AAACGCCCAGGAAGGATATAGCACAGTAGAATGGGCCCGAGGGGAGGAAGAGGAAATACT
GGGATGGTTGGAGGATGTTAGAAAAGTCGCTTCCCTTATCCCGGGACCCCGTTTTCTCAC
ACATAAAATGGACATGATCTCTGGAGACATTTGCTTTCTTTTCTCATTGTTTCCTCAGAA
GCAGAATGTGTCTTTTTGTAACTTTGGCCTTGGGAATCACCTGTGTGTTCATCTTCCTTC
TGGCTCTTCAAAACTAGAGCAGTTCATGAAGTCAAGTGTATGGCAGGGTTTTAAAAGAAA
CCCCAAACTAAAGCAATTCAACCTCTTCAAAACTGAGTCACATCAGATTATTTGAATGGT
TAAGCTGATGTTCTGTGAGGTACAATAGTTAATAGCATGCTAGAGTTCTGATGGCAGTGT
AAAAAAAAAAAAGGAGTAGGATTTAATAACAGCTGGTTGCATCTTTTAACAGACTTTAAC
ATAATTAATTTTTTGCTCTTTTGCCAATTTTTTTTTTTAAGACAGAGTCTCACCCTGTCA
CCCTAGGTAGAGTGCCACTGCGTCATCCTAGCTCACAGCAACCTCAAACACTTGGGCTTG
AGCAATCTTCTTGTTTCAGCCTCCCAAGTAGTTGGGAGTATAGGCATGTGCTCCTATGCC
TGGCTTGTTTTTCTATTTTGGGGAGAGATGGGGTCTCACTCTTGCTCTGGCTGATCTTGA
ACTCCTAAACTCAAGCAATCCCAGAGTGCTAGGATTATAGGTGTGAGCAACTGCTCCCAG
CCATTTTTACCAAGTATTTTGAATGTGATAAGTATGTTTTCTTCTCTTCTGTCTCCTTCT
GGAATCTTCTCACAGCAAGTCTGCTTTGTTTATCTTCTTTGGGGTGCTGCCTCACCTCTA
TTAGTGTGATTTTCACAAGGCTATCAATCAAGGGACACATACCTAACAACATACACTCTA
ACCTCTATCAAAGCAGTTCACCCAGTCAAGACCCATTAGACTTACTCTCATGGGAATTTA
AAACATTTAAAATTGAGATGGTCAAAAGCACTGAATCATCTTTACCCAGAGAACACAAGT
GTCACCTGGGAAACCTGTTAAACTTCTTGGTCATCATTCCCAGAGATTCTAATTCACCCA
GTCTGAAGAGGGGGTATAAGAATCAGTATTTTTAATGGAGAACAGACTTCCGAAACTCTG
CCTTAGAAATAAAATCCATGATTCTCTTCTACTGAGAGCCGCAGAATTGCCTTGATTTCT
GTTCTTCCTGAAGTTGTTCATCTCTCCATTCAATTTTGTGAGCTATCAGTATTTTTCATT
TTCCCTCTTGTCCCATTTTGTATTATTTCCTCTTTTCTCACTTAAATTTGAGTCAGTTTA
TATTGTTTGGAATTAAAGAATCTAAATGACACACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved