Otolemur_garnettii Locus Mono:279:SNORD77
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:279:SNORD77
Otolemur_garnettii
Mono:279:SNORD77
GeneScaffold_1044
SNORD77
1001..1068
2068
CATCCAGGAGGTGTGCTGAACACCCCTACATTGTGCACGAGGTGAGATCCCACCAGTCA
CCCTCCTTCCTCACTCCCTCCTCTTCCCTCCCCCTTTTCTAGACTATACTTGTGTTTTTT
ACTTGTCTTTTTCTTTGTGTGGGCTTGCAGTTTATATACTGGTTTCATATTAGTATTGAG
TACACTGGCTACTTTTTCCTCCATTCTTGTGCTACTTTACTAAGAAGAATTGCATTTCAA
CTCCATCCAGGTAAACATAAAAGATGTAAAGTCTCCATCTTTTCTTACGGCCAATAGTAC
AGAACATTTATTTATTCATTTTTTATTTTTTCATTGAGACAGAGACTTTGTCACCCTTGG
TAGAGTGCCGTAGTGTCAAAGCTCATAGCAACTTCAAACTCTTGGGCTCAAGCAATTCTT
TTGTCTCAGCCTCCCTAGTGGCTGGGACTATAGGTATCCACCACAACACTGGCTATTTTG
TTGTTGTGTTTTGGTTTAGCTGGCCTAGGCGGGTTCCAACCCACCAGCCCTGGTGCACGT
GGCCTGTACCCTAACTACTGAGATACGGGCACCTGGCCAGTACAGAATAGTCAAATAGTT
ATTATCTTATCAATAAAAAGAATTCGAGTGAGCTTCACTGTTATATATAAGCACAGAATA
TAAAATTGAAAAAACCTGTACTTTGGGATATAATTCCTAACTAAAGTGGGAAAAATCTTA
ATAACTGCTGAATCTGGTGATGTTGACATGACATGACATGACAGTGGAGGTCCACTGTCT
TATTCTCTTTACTTTTATGTGTATTTAAAATTTTCATAATTAAAAAAGGAAACATATCAA
AAGGATTTGCTAAAAATAAAGTGATAGGGAGTAAAACAAAAATAAGTGGGAGATGTGATC
AGGAAGTAACCGCAACCTCTGAGCACTCAGAGAGACGTCACTCTAAGCCCTTCACAGTGA
TTAGCTCTTCCCCTCGTAACAACCCCGTAAGAACAGAAACCATATGGTAATGGCTGCATG
GCTCAGTAGGCTGAATCATAAAGAGATCTACCATTTGTCTGATGTAAAAAACAAATTAGG
GACTTATTAAAATCCCAAGAATCTTACAGATAAGAAACTGAGACTTAGATTAACTTGCCT
TAGGTTCTACAACTAGTAAGTAGCAGGGCGAGTAGTCAAATCCACAGAAAACGTCTCTAC
ACAGGCCCTACTCTCAAGCACAAGACTTTACTCTCTGGAAGGAGATTATATTTTTTAGGC
AAATGCTAGCCAAACATTTCCCAAGGTTTTTTTTTTGAGACAGAGTCTAAAGCTGTCACC
CTAGGTAGAGTGTTACGGTGTCACAGCTCACAGCAACCTCAAACTGGGCTTAAGCAATTC
TCTTGCCTCAGTCTCCCAAGTAGCTGGGACTACAGGTGCCCACCACAATGCCTGGCTATT
TTTTTGTAGTTGTCATTGTTGTTTGGCAGGCCTGGGCTGGATTTGAATCCACCAGCTCCA
GTGTATGTGGCTAGCGCCTTAGTTGCTTGAGCTACAGGCACTGAGCCTTCCCAAGGTTTT
GAAACTACATTAGCCAAAAGTTTTTTTTAATAATGTACGATAAACTGAGTCAGAACTTAA
GATCTATCCTATCAAATAACTGAAAACATACCTCTCCTTACTGCTAATGATAACCTAAAG
TATCAAGCCAATATTTAGGTCAAGAACAATTAAAATTTCCAACAGCTTTTCTTTTAATAG
AATCCCCAGGAACGAAAAATTCCTAGAAGTTATATAGTATTATTTATTCAGTATCAAGCA
ATATGACGCTATGATCCCAAACCATAGGGTCTTAAGCTAAGAGGTGTTTTAACTTTCATC
TTGTTTGAACAGGAGTCACTCCTTGACCAAAGCTTGCTTTCTTCTCAGTAGGCAGATGAG
AAATGCAGAGCCTGACATATTCACATGATTCTTTTTTGACACGTCTGGTTCTTTGTGAAA
CAGCAGGCCCAGGAAGAGAGCGCCAGCCTGCCTCTACACGCAGCCGTTCCCTTCCCCATC
AAAGCCCAAATGCAATCCCTGGGGACGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved