Otolemur_garnettii Locus Mono:221:SNORA25
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:221:SNORA25
Otolemur_garnettii
Mono:221:SNORA25
scaffold_75793
SNORA25
1001..1126
1426
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATAT
AAAACCCGGGATCAATTCCTACTTCAACCCTGCTATCAAATACTAAGCCTGTAACCACCG
CATGGTGGGGAGAACAACTTAGACTCCCAGATTACTAGTATCTCTGGCTCCTAGCAGGAA
CAAATTCTCTCTGAGGAAATCCTTCCTATTCTAGGCGCTTAGGATCCCATGAATTCTTTC
CAGTCAGTATGGGTTCATGATCCTTTTGTAGTTCATAAGCAGGATGAAATGTGCCTCCCT
CAAACTTTGTTATGATATCATCATATTATCCATCTGTGTAAAAAAACAGATGTGAAATGT
GGCTCCCTCAAACTTTGTTATAATATCATATTATCCATCTGTGTAAAAAAAAAAAATATA
TATATATACATACATACATACATACATATGTATATACACACATATGTTAGGTTCATGCCA
CAAGTAAGAATCAGCAAAACAACAAAAAATGATTTAGACAAAGGTCATTTCAAAGAGGGC
TCATAGGGCTGTGAAATCAGGAGCTTTTATTGTCATCACCAAAGATTGAAGTTCTACGCA
GGATGCCATAGCACTCAGTAGGGCTGTTTTCCTAGGGTGCTATAGGACTTTGCCACTCAT
TATGACCCATCATTATTGTGTCTCAAAGTTTAACCAATGTATCTCTTCTTCAGAAAAAGT
AATTTAGACCCCCGAATACTAAAATTATCAGATTCATAATATACCAAAAAGATATGTAAA
AGAACCAAACAGAACTTCCAGACGTGAAAATCATTAAAATTAAAATTTCAGAAGATGGGT
TATACAAATTAGACACAACTGAAGAAAGAATGAAAAACTAGAAAAGAGATATGAAGAACT
AACTCAAAACGTAACAAAGAGAAAATATGAGAAGATATTAAGAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved