Otolemur_garnettii Locus Mono:146:SNORA48
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:146:SNORA48
Otolemur_garnettii
Mono:146:SNORA48
scaffold_115351
SNORA48
1001..1133
2133
TGCCTGGCTATTTCTTGGTTGCAGCCGTCATTGTTGTTTGGCAGGTCCGGGCTGGATTC
GAACCCACCACCCTAGGTGTACATGGCTGGCACCTTAGCCACTTGAGCCACAGGTGCCGA
GCCATATGTTCCCAATTTTAAAACTACCTAAGTCATTTTTCCATCTTTAATGATTTTGAC
AGTCAACTCAAATTTCATGATTATAAACTGTCTTTCCTAAACACTTCCATATTCCCTTTG
AACCACAGAGCATATTCTTTTGTCATTCATGCACTGATTGGTAAAAATCCTGACATTCTT
TTCTAGTAACATTAGCTCAAGCACAGAGTTTGGATACCTCACACATTGTTACAGGAGACA
GTGCTGGGTTGTACTTAATAGCATGGACTCTGCTGTCACAATGGCTGACATTTGAATATG
AGGGATTCAGCGTATTCTGCCACTTAAGCTCTTATTACCCTTCATTATACAACATTTCCA
GAGCAATAAAAGTTATTTATTTAATGGGTAAAGGTTAGGAAACAGAAAGTAACCTTAGAA
ACCAAATAACATCAGATAATACTTCCAAATACTCAACGCACTCCCACAACCACCTTCCTC
CCACCAACAAATCTTTGCATATTTGAAGATAAATATAACTTCTCCAAAAGTTCGAAGTCA
TATTTCAAGCTAGGTTTTAGATGACTAGAAGTACCATATTCAACAAGAGTGAGGGTGGAT
TAGTTGGAGCAGTATTTTCCCCAGGCACCCCATTTTTCATTTGTTAGTCTAGTTTCTGCA
GAATCTCTTATCTAACTTAAGGGAAATTAGTCATTTTTCCAGGGAGGTTCTTTTTCATCC
CAGTAGTGAGTATCTCATCCATAAAAGCTGGGACTTCACTTTCTCCTTTTCTTTGAACCA
CTGAACCCAGTTACAACAGAGTGTCCTTCCATGGTCTTTCCCTTCAGGCCGTTTGCCATC
TAGCGTATCAGAGAGCATGCTCACAGATTAATTCAGTGTGATGTCCCTGAGCTGGGGCGA
GTGGCCCTTGTGGGTGCCCATCTCGCATCAGCCCAGGGACAAAGCAACTGCTCATTTATC
CCAGCTTGTTTTTTTGGCCTGTGCCTATATCTGGCTCATGGTTCCGACCCAGGAAAAAAT
AAATTCAGTGTGATAGGAACAACAGTAAAGCAATGTACAGGTGAAATGAAGGGCAGGTAA
TAGGCTCAGGCATATTTCCACATCTCAAACCCAGAATAGCAGGTAGAAAATAATGTTATG
CATAAATATTCGATAGGCAAATTAACTAAGTTTATTCCAGTGAATAATTAATTTAAATAA
TGTGTTTTTTACTTTGTGTCAAATATTTCTATTGCACCATATCAACCATTTAAAAAATGA
TGATAAATGGGGTTACTGAGTACTGTGTAACATATAAGGTACACTTAATACTTCAAGTTC
ATTATCAGACTTGTTATTTCAGTGCTTTAATTTCTTTTAACTAGGCTGGATAAGCTTGTA
GAGAGTCTAAGCAGCACTAATTTAATGCATATAGATAAAAATAAACTTTGTAATAAAATC
TCAAAATAGATATCAATATTTAATGGGTGAGTTATTCTAGATTTCTACTGTATGTATATA
ACGGTACATCCTGAGCCAGTCACACAAACTCATTTATCTCTGCAAAAGAGTTACATATCA
GCCCTTTATTTCCCCCAAGACACCAATATGTGTGGTAATTATAACATAAGCATCTTAATA
TTTCTGTCATCTGGCTGATATATTTGGGATTTCTTAATCATTTCTGCACAAAAATTCCTT
GGTAATAGTTCAAAAGATATAGTTTCTGTGCAAGAAATTAAATGAGAAACTAAAAATGTA
AGAACATAAATTAGTCTGAATGTGGCAAGTCTCTTTATTTGTAATACTACTAAAAATTCT
CCTTTTCCCATTTTAGTTGTTTACTTTTTTAATTTCAGGATCTTACAGGGGACATACATT
TTGCTTACATAGTTTACTCGTGTACATTTTAAGTCAAAGTTATATTTGTGCCTCTCACCC
AGAAAGTGTGTGATGTACCCTTTGGGTAGAACTTTACCCATCATCCCCTTCTCCCTCATA
TCTTCTTGAATGCCACAGAATTTACATCCACATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved