Otolemur_garnettii Locus Mono:46:SNORA11
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:46:SNORA11
Otolemur_garnettii
Mono:46:SNORA11
scaffold_95678
SNORA11
1001..1130
2130
GTCTTTCCAAAGTGTGTACTAAGGATCCCAGGAGACAGAGATACTGAGTAAGACCACCN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGGCTGCTGCATTTATGCA
GTTGAGGTAGTGTTGTGTACTGACCCAGCCTCAATAAGTGACTTGTGGCAAACACCATCC
TGTCTCCCATCACTACTGAGCTTTGATTTTAGGCAGAGAGGCAGGTCCACAGCCACATGT
TGCAGATGACGAGAATCCATGATTTGCAGGGAGCCGCCCAGTCTGTAGGGTTTCACTCAC
GTTATGCAGGGGTCACCCTGGGCAGTCTATAGAATTTGTTTCTATAGACAGTATTTAATA
CTTAGCAGTTTCATAACATCCTCTTGTTACCTCCTCTGTATTTTTGTGACCTTATTTTAA
TTAATCTCTTGATCCACTTTCCGACTCCTTCTAACCCTGGATTCATCACTGATACGTATT
GGCGCATAGATCTTGACTCTGGAAAGTAAATTTAATACAGCTTGGATTCAGAACCATGAT
ATTTCAGTTGAAAAGCTCATATGTCTGAGCGCTCATTAAATTCAGTTCAGAGTGAGTGCA
AGAGTAGACTTTCTTGTTGGGTAGGAACACAAAGCACATGCCACATGCCACATGCCACAG
TGATACGCATTTGAAACACACCAGTCAATGTACTTCCTTTCAGTTAAGAGAAAACTGCTC
CCGGGTGCTGCTGTGATACAAGTTTGCCTTCCTGGAATTCTAGTATGGCAAACTTGCATC
CTGGTTGTTATTATTTTCAAAAGGAACTACCTTCTAGAAGTACTAGATGGTACCCATAAT
ATTTAGATGTTAACATAAATATTATCTTCTTACCTATATGAGGGAGTTCATATTTCATTA
AAACGCACAATTCTTTGTAAAATCTAAATAATAGCTTTTAAGGGCTGTACTCAGATCAGG
GGGCCTAAAGAATGGCTCCTCTGTTTATAACAACCCAACAGGAATCTGGGGTGATTGTGA
CGAGGGGCGCATAAAACTTGTGGCCTCCCTAGGAACACATTCGCTACAGGTGAAGAAGAA
GAAAATTATAAAATGCATGTGGTGGGTGTATGAGCCATCGCTGGATAATTTTTTCAACTG
TACTGCATGTTTGAAAAATTGCCTAATAACATTTTCAGAAAATTAAAAAATAATAATAGT
GACTGTTAAAGTTTTCTCTTCTCTCCTCTCAACATTCAATGCTGTGGGCGGTTATTATAT
TAAAATCCACAGGCATTTACTTCTGCAATGAGCGCTATTCCTAGAAATATGTCTTGTTGA
TATGACCTGCTCAGGAAATAGAAAAAAATAAATAAATAACGGAGTCATGAAAGATAACGT
TTCTTCCTTACAAGCCGAAGAAGAAACCTTATTTATGAACCCATCTCCATTTTGCTGTTT
TTCAAGGATGGTGGCTTATTGCCCTGAATTTTTTGGCAAAAGGCCTTCCTAAAGGGTGAG
ACTACCTAGATATTACTCCAGGCAATCAGCTTTCAGAAGAGAAATACTTAGGAAGGCACT
TTGCTAGACAGGAGAAATTGATGACAGTGGCCGACAGAAAAGCAGAAAGTGACTCATAGT
CCCCAGTTCCATGACTAGATGTGTAAAAATGGAGAAAAGAAAATCAATGAGCAGTACATT
AAGTAGGAGATTGAGCCAGGGCCTGGAGTAATCAGGCTTTTTCTCTAAAATCCGTTCTCC
TTGTGTTACAACAGCTCTGCTAAGCTGCCCAGCCAGTGAATTCAGTTTGACTCACAGGGA
GGAGTGTCTGCAACACGTGTAGAGTCTCAAGCCTAGTGGGTTTTCTTGAATCTCTGTGAC
TTGGATCTGCTGGGCAAAGGAGGCACATGCAGATCTTTCATTAACAGGAAAGGCTTTACA
GGGATCCTCCAGAGACAACTGCCCCAAATCTGAGGACGCCTAGGAGGTTGACGAGCCCCA
GGAGAAAATCACAAATGATATGCAGGCATAATTCTTGCCCATGTTGGAACGGTCATAATT
TACGCTTATTTTTAAATTATTTCAGTGTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved