Otolemur_garnettii Locus Poly:7:SNORA17
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:7:SNORA17
Otolemur_garnettii
Poly:7:SNORA17
scaffold_117058
SNORA17, SNORA43
1001..1131, 1762..1891
2891
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA
GAGGAACTGCTTGGTGGTTTTCTGGTGGGTACTGTCTGGTCCCTGGATGTCTGCAGAGAT
GCAGCAGTCAGTATTCTGTTGGGTTTCTGACAGCGCCACTGTGCGTAGCCGGAATTTCCA
CACACACCTGCAAGTTAAGTGGGAAGTAAGGGTAGAGAGTTATATGTGTTGGATTTTTCT
AGAACGGTTGTTGAAGGCACGAGCGTTCTGGTGGCAGGGACCCTTCATAGCTCTGTCTCC
CTGGAGACCAGCTCCCCTGTGATATTGCCACGATTTGAATGAAATGTTGGTTTCTTCCCT
AGGGAGTTTGTCCACTGGAAACTACACCTGTGAGGGATGCTGGCGTCTTGGGTAAGTTGA
CGCTTTGGTACTGGAACAGGTTTGCTCACTGCTCAATACAACCATCCCCTTCTCTGTGAC
ATTCTAAGTGACTGGGGACTGATTGGCTCTGCCTTAACAGGGTAATGAGAAGTTCCCTCT
ACAGGGGAATAAAAATGTAAATTATTCCATCTTCAACAGCAGCTTCCCCTAGAGGTGTTG
CAGATGTGGCTGCTGTGCCACATTTGTGTCATTAGGGGGCAGAGAGAAAGAGGCTATGTC
TACGCTCGGTGTTCTACCCTGTGAACACTCGAATGATTATTAGTCTGACACGTGGGCAGT
GTCCTAGCGCAGGGGTTTGTGCTGCTCCCCTAGCTCTGGTTCTGTGGCCTTCCAGTGTGT
CTGTGCTCACCAGTAGCTCTGTGAAAAGTGTAGTGTGATGGGTGCAGAAATCTGGAGTGG
GCCTCCTGACAGGCATGGTGACCATCCCAGTTTATCCAGCACCTCTCAGTCCTCACTTTC
TAACCCTCACTTCTGACCATTTGATGTCTGAAAAGTGGCAGTGGGGAGGTAGAGGATGCC
CTTAGGGGCAGCAACTTTGGTTGATTTTAGTTTTAAAAACTAGCAATAGGAAGAATAAAG
GGTAATATTTGCTGGCTGATTCCTACTGGCACCTTGTTGAAGGGGTGATGTTTCAGAATC
ACCTTGGAACGTCTGGCACTAGGGGAGGTTTGCTGGTGCTTGGTTCAATTAGTGACAGCC
AGCTTGTGTTGTGCTCTCACGTCTGGGCCAAGTGTTCTCATTATTTAATACAGGTGGGAC
AGTGACTGTTAACCTCTGAGGATCAGCGTACGTTGGGAGCATTGGCCAGAGCGATTGGGC
CAGCGTGGCCTCAGCCACACCTTGGTAAGGAGACAACGCCTCAGCCCTCTGAATCTCCCG
CCACTCTGGCTACCCTACAAATGCTGTACTGGACCTGCCAGCACCGCAGGTGTGGCTGTG
CCTGTGACAACAGGGCACAGAGAAAGTAGCTATTTCTATGCTCAGTGTTCAGAATCCTGT
GAGCCCTAAGAATGGTTTATAGCCTGACATTTCTCAACCATAGTAAGGTAGCATTTAGTT
TTGGTGTTTTTTTTGTTTGTTTGTTTTGTTTTTTTGATTTTTAGAGACAGAGTTTCACTT
TATTGCCCTGGGTAGAGTGCCATGGCGTCACACAGCTCTCACAGCAACCTCCAACTCCTG
GGCTTAGGCGATTATTTTGCCTCAGCCTCCCAAGTAGCTGAGACTATGGGCACCTGGGTT
TTTATTTTTTGTGGGTTTTTTTTTTTTTTTTTTTTTGAGACAGAGCCTCAAGCTGTTGCC
CTGGATAGAGTGCCGTGGCATCACAGCTCACAGAAATCTCAACTCCTAGGCTCAAGCGAT
TCACCTGTCTCTGCCTCCCAAGTAGTTGGGATTATGGGTACCTGCCACAACGGCTGGCTA
TTTTTTGGTTGCAGCCATCATTGTTTGGCCGGCCCAGACTGGATTCAAACCTGCCAGCTC
AGGTATATGTGACTGGCACTGTAGCTGCTTAAGCCACAGGCGCTGAGTCCTAGCTATTTT
TTGTTGCAGTTGTCATTGTTGTTCAGCAGGCCCGCGCCAGGTTTGAACCCGCCAGCCCTG
GTGTATGTGGCCAGCACCCTACCCACTTAGCTTCAGGTGCAAAGCCATAGCTTTTAGTTA
TGCTTTGGCATGACTCCACCTCTGGCTCCGAATGGTGTGTGCAGTGGCCACAGTGCTGTA
CTTTCAGGTGTTGCTGGAAACCCAGGCAGGAGACTGCACTTGGTTTCAGCTTCTTCATCT
ACAAAGTGGGCCTGTTAGGATTAAATGTGATGGTGTATCTAAAGCTCCTGGCCCAGAGTG
AGTTCTTGGTACAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved