Otolemur_garnettii Locus Mono:158:SNORA63
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:158:SNORA63
Otolemur_garnettii
Mono:158:SNORA63
scaffold_118232
SNORA63
1001..1111
2111
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTGTAGTCACAGTTACTGGGGAGGGCGAGGCGTGAAGCCCTGGAGT
TTGAGGTTGCTATGAGCTATGACACTACAGCACTCAACCCCAGGGTAACTGAGTGAGACT
CTGTCTAAATAAATAAATAGATAGATAGATAGATAAAAGAAGAGATGGGGGGCCTTATGT
AGAAATGGCAGCAGGTGCCAGTGCACATATCTGTACGAAGTGAAAAGAGGTGAAAGTTGG
AGAACAGCCACAGAGAAGTGGGGCACAGACATAGCTGAGATTCCAAAACTTGTGCTGAGT
TTCTGTTTGTTATCCTCTGCCAACTGTGTGCTATTCTGTGAAGGCTGCTGCTGAGGAGAG
ACAGTCCAGACCAAGGTTGAGGTTTTTAAATGAGAATCACCGTGAAGATACTATTACAGT
ATAATTGAAATGTTTTATTATTGTTCCCCATGCTTAAAGCATTTGATGCATAATTATCTC
TGTCTAAAGGCAGAGATTTTGGTCTCAAGCATTTTTCCTTGAGTAAAAATGAATTAAAAG
ATACATAAAGGAGAATTCCCTGAAGCTTGGTTAAAAAAAATTAAGGAAGCTTCATATTGG
TGATGGGGAAGGAGATAACCCTAGGTCTTTTTCATTACATATTTAGGGAATAAAACAAGC
CTAAAAATTGTAAACTAGTTAATAAAGATGAAAACTTCTGTTCTATGTGTAGAAGTTTTA
TAGATGGTGCAAATATCATGTAGTTCAAGTTATCTGTGAATGTTGAGTTTGGGGATTAGT
ACATACATTGCTTGAAACATCGTTAGATGGAATTGTGTATTTGTATTGAAACTACAAATA
ATGATGCTTCATAAAAAATAATGACAGTATAGGGGCGGTGCCTGTGGCTCAAAGGAGTAG
GGCACCGGCCCCATATGCTGGAGGTGGCGGGTTCAAACCCAGCCTTGGCCAAAAACTGCA
AAATAATAATAATAATAATAATGACAGTATAACATCCTTGTTAGTATTTTTTTTAGTTTA
CTCACAGTTTTCACCTATGATCTTGATTTTTTTTTTTTGAGACAGAGTCACCCTCAGTAG
AGTGCTGTGGCTTCATAGCTCACAGCAACCTCAAACTCTTGGGCTCACGTGAATCTCTTG
CTTCAGCCTCCCAAGTAGTGGGGACTACAGGCACACACCACAATGCCTGGCTATTATTTT
TTTTGTTGTTGTTGTCATTGGTGTTTAGGAGGCCCTGGCCAGGTTTGAACCCACCAGCCC
TAGTGTTTGTGGCTGGCTCCATAACCACTGAGCTACAGGTGCCGAGCCTGTAATCTTTTT
TATATTTTTTTTTATTTTTTGATACAGAGTCTCACATTATCAACCTTGATAGAGTGCTGT
GGTATCATAGCTCACAGCAACCTCTAGCTCTTGGGCTTAGGCGATTCTCTTGTCTCAGCC
TCCCGAGTAGCTGGGACTATAGGCGCCTGCCACAGCACCCGGCTATTTTTTTGTTGGAGT
TTGGCCAGGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved