Otolemur_garnettii Locus Poly:0:SNORA73
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:0:SNORA73
Otolemur_garnettii
Poly:0:SNORA73
scaffold_96607
SNORA73, SNORA73
1001..1203, 1581..1784
2784
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGCAGCCTTTTGGGAACTGGTTTGCAGTTTCCGCTTTTGTGATCTGGTAAGGGAT
TTTATTCGCGTCGATCCTCAGCCGAGTACCTTGGTTTGGGAACTAGGCTTTCTCACGGGG
ATCGTACTATAGAGGAAAGTTTTACCTTCTGCGGTGTTCGTACGTGAGTTCGGTGTGGGC
CGCGGAGAACCGGGCCTGCTCGGCTGCCACCCAACTCGCGGAGATGCTAAATGTGCTGCA
CCACCTCTGCTAATGTTGCTTGTTAACCGTGTTTGTCTTCCTCTTAGTAGGTGCAATCCC
CATCCGTTTCGGAGAATTTTAATTCTCTGGTAAATGGATCCAATTTTGCCATTTGTCTTT
TTGTGATGGGTGTAGTTGAACGACCCACAAACCCAATTTCATTGTAATTTTGACATGACC
TTACGCGTGGTACTGAAAGATTTCTAGATTAGTTTGGTATGTCTGAAAACTAAAACTGCT
GATACAGGACAGATGATCTGTTTTGAAAACGAATTTTGTTTTTACTTCTTGATATTGGAA
AGAAGGAAAACTTGTTACCCAGTTGTCTGGGAAACTAGACTACAACGTGGATACACCCGG
GAGGTCACTCCCCGGGCTCTGTCCAGGTGGCATAGGGGAGCATAGGGTTTTGCCCCATGA
TGTAAAGTCCCTTTCCACGACGTTGGAGATGAAGCTGGGCCTTGAGTCTGCACCTGCATA
TTCCTACGACTTCCCAGAGTCCTGTGGACAATGACTGGAGAGACAAACCATGCAGGAAAC
AGTCTTTTAGAGCACCTAAGCTTAATCTTAACTCAGCTTCAGTTTATTAATTGATTAATA
CCTTATTTTGCAGAATAAGCAGTAACTCCAGTAACTCCTGAGGTAAGTAGCTGTGGTCTG
AATTTTTGGTTTATTGATTAGTAAGTAAATCTACCCTGGATTGGTTTTAGGTTGTTGATG
TGTTACATTTTTGTAATGGAACTAGGAGGGAGGTGACCCCTGTTATAGGCAGTCAAGAGC
CACCTCTAAGACGTTTAATCTTCCTGTGCTCAAAACTTCTGTTTGATAATATGCAAACAT
AGATATTGCAAATATTTTAAGGGGTGATGTTTAGAAAAACTGCATTTATGACTGAGTGAT
GTTTGTACTAATCAAAAGGTTCCAACGTGGATACCCTGGGAGGTCACTCTACCCAGGCTC
TGTCCAAGTGGCGTAGGGGAGCATAGGGCTCTGCCTCCTGATGTATAGTCCCTTTCCACA
CCGTTGGAGATGAAGCTGGGCCTTGAGTCTGCACCTGCATATTCCTACGACTTCCCAGAG
TCCTGTGGACAATGACTGGGGAGATAAACCATGCAGGAAACATGTACTGCACTAAACTTT
CAGGTTAAAGGATGATCTTTGAGAAGCTAATCATTATTTCTTTCCCTTTAGGAAAGAACT
GTACAGGGTGTCCGTAAAGTTCTTCTGCAATTTGAAATAGTTTGACTTTGTAAGTATATA
TGATAGAATTTGTAAAAAGGGTTAGAGGGCTTGATGTGTCTTATTTTTGTGTGTGTGTCT
TTAGAAATTTTATTTTTTGAAATGTAATTTAAAAATTAATTACTTTTCAGAATCACTGAC
CTATGGCTTCACTAGAAGAGAAAGAAAGTTTTGTTCTTTGGTTGATTCAACTAAAGTCTG
CCACTGCTGTCCAAAGAAGGTTTAGAACCCATTACAAGAAGGAAGCACCACACAGGAATT
CCACATCAAAGTGGATGGAAAAATTGAAAGAAACAGGCTCTGTCTATGATAAGCCATGGT
CTGGGAGGCCACATGTTGGTGAAGGAACTGTAGCATCTGTAGAAGAAACCTTTCAGGCAA
GTCCAAGAATGTCATTAAGACAGGTATCCTTAGAGCTGAGGTTTCCAAAGTCTGCTGTAC
AGAAGATTCTGCGGACAAGACTTCACATAAAAGCATACATAGAAAATTCAAGTGCATCAA
ATGTTAGGAAAGGATTATCATGACTAATGAGTAATGTTGATGTAATGTTGAGTAATGTTC
TCTGATGAAGGAACATGACCCATTCGTGGCAAAGTCAACAGGCATAATCGTCATCTATGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved