Otolemur_garnettii Locus Mono:328:SNORD35
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:328:SNORD35
Otolemur_garnettii
Mono:328:SNORD35
GeneScaffold_5597
SNORD35
1001..1088
2088
ATTATGGGGCAATAGTGTTTATGTGACAGAATCTGTCTGTTCTGAGCTAGCTATTATCG
CAACTACCAAGTCAATCAGACAAGAGTCTCAGTAGCAAGTCATTGTGCTATGAAAAAGGT
ATCCTCCAAGATGGACCCAAGCTTATCTAGAGGGCCACAGTCATTTACAGGATGAGTTGG
CTGTGGCCAACTTCTACCTTTTTGTACTGCAATCTCTTAGAAGACAGGAAAAAAAAATGC
AGGTCTGGTCCACAGATGGGTCAGATATGTTGATATGTGCTGAAAATGATCTACTGCTGT
GCTATAGTCCCACTCAGGGTGGCTGTAATGGACAGCAATGAGGGGGACCTTCTCCATAAG
GCAGAGCTTCAAGCAACACATTTGGACATTCACTTTGTATGGACAGAGGGGATGAAGCAG
TGGCCTAAGGGAGAAATGCATATATACTTCTAGGATGTGATAGATGTCCTGCTGGTTGTC
AGGGACCTGTAAAGAGCAAAGGGGGATGATTAGAGGCAAGGACATCTGGGGAAGAAGATG
GATCTATGGGAGTGGTTACAAAATTTGTGTGTGTGTGCCTTTTGTTAATACTGAATGCAG
AGGAGTCACTGAATAACAAGGTAGCTGGACAGGATATTTGCAGCCAGATTTGTCCTTGGC
TGCCCCTGAACTTGTACAGTGGGCCCATGAATGGAGGAAACATGGTAGCCAGAGTGCAGG
TTATGTCCACCAGTACAGGTCCTCTCTTATGTAGGCCTATCTAGTTGTTACTGCTGCTGT
CTGACTTCTTAGCAGCTGAGCCCCTGCTATGGTACCATCCAAAAAGGACACAGACTAGTC
ACTTAGTGGCAACTTGATTATAGCTGATCATTTCTACCCAGGAGAGGGCATCGATTCATC
CTCACTAGAATTGACACCTGCTCTAGGTATGAGTTTTCCCTCTTTATCCATAGTGTCTCA
GGCTAGTGTTATGATCCAGGAGCTTCAAGAATCTCAATTTACGCAGGTGATGTCCATGTT
CACAATGGTCTTCAGATGCCCAAGTAGGGCACTGCTGAGAAAAAAAAAAGAATCTCAGTT
TACCAACATGGGGTCATGTATAAAATCGAGTCAGTTCACTGTAAAGGAGATATGGCAGTG
TGTGGATTGCCATGGGACCTACTGCTTTTCTAGTATCTTGCATTATCCACAAACAGCCCT
TCAAACAGAAAGATGGAATGACCTATTAAAGCAGTGGTTCTCAACCTTCCTAATGCTGCG
ATATATTTTCATTGTTACAAGGGGGTTGTGACCCACAGGTTGAGACTCGCTGTCTTAAAG
GCTTAGCTAAGACCCTCACTCTAGGACAGTATCCTGAGTAGTTGGGATATGTACACTGAA
TCAAAACCCAGTGTATGGTGTTGTGCCCCTAGGAACTCAAGGGTTGAGATTAGCCACTTC
TCACACATCATTCCCAGTGACTCACATGTAGAATTTGTACATTCTGTTTCCACANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved