Otolemur_garnettii Locus Mono:381:SNORA11
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:381:SNORA11
Otolemur_garnettii
Mono:381:SNORA11
GeneScaffold_4212
SNORA11
1001..1129
2129
CACATAAGTGAAATTTCAGACTACAAGTCTATAGATGATGATATCCTAGATAAATTTTC
TCAAAGTTAAGAATCAATGATTCGGCTCGGCGCCTATAGCTCAACCGGCTAAGGCGCCAG
ACACATACACCTAAGGTGGTGGGTTCGAATCCCCAGCCCGGACCTGCCAAACAACAATGA
CGGCTGCAACCAAAAAATAGCGGGGCATTGTGGCAGGCGCCTGTGGTCCCATCTACTTGG
GAGACGGAGCAGGAGACTCGCTGGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTAATGC
CATGGCACTCTACCCAGGGGGACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAAAAAAAAG
GAAAGAATCAATGGATCAAACCATATTCAAGAATAAAAATGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNAAAATGTTTTGAAGCTAAGAAGCAAAGACGATGGCTATCGTTTCTTTAAAATA
ATAAGCATCAAAGTTTCAAAAGCATGCTTTCTGTTTATTCAATGTAAGAAGAAGCAAAAG
TAACGATAAGCTTAAACCATTAGAGATGTATTTGAAATCTGGTATTCAGTATTTACAAGA
TGACCGTGTTCTTGGCTCATCTCTGTTGACTGATAAATAGTTGTATTCAAAGAACATTGC
CCATTTAAGGCAAATATGGCATCAAATGCAGGAAAATACAGACCAAATTACTGGGCTTGC
TGTATTTAAAATAAGATTTATTTAAAAATTATTTTTCACTAGGGGTGTGCTCGGAGCAAG
GGGCCTGAAGAATGGCTCCTCTATTTACAACACACCCAACAGGAATCTGGGGTCACTATG
ATGAGGGGCACAAAACTTGGTGCCTCCCTATGAACAAATTCCCTATACCTGAAGAAAAAG
AAAACAATTATAAAATGTCTGTGGTAGATGTACGGGTGATCACTGTATAATTCTTTCAAC
CATATTGTATGCTTAAAAATGCCTAATATTGGAACATTTAAAAAATTATTTTCACTATCG
CTTTATTCTTGCTTTTGTAAATAATTTGGGAAATGACTTAGACATATGAAAAAAAAAAGA
ACAGGACCACTGATGATGAATGTTTTCTCTGGCACAGTGTGAGATAAATAGACCCAGGTT
TGTCTCACATGACAAGCAATAGAGAAGAAAGAAAACACAAACCTCTTATGGACTGCTTTT
GGCTTCAGAGAACATAACTACTCTCACCTGATGTGGACTGTCAGCTTAGGACAAAGGGAC
GGTGGTTCTGTAATGTCACCAGGGATCCAGCTTGCTTCCACCTCTCTGTTCTGCCATCTC
CAGTTCTGGTTTCATCCTCAGGGTTGTAGCAAGATAGCTGTGACGTTAGATCTAGACCTA
TGCCATCCAAAAAAACAAAAAAACCCCACCTACATGTATCTTTCTGTTAACAGCAAGGAA
ACTTTCTAGAAGTGCTCTTGCTTCAAGCTCCTTTCCCCCTCGCAAGCTGTGAGGGAAGAA
GGGGTAACACAAACTCCAAAAGGGCCAGATGTGGTGGCTCAGGTCTGTAATCCTAGCACT
CTGGGAGGCTGAGATGGACGGACTGCCTGAGCTCAGGAGTTCAAGACCAGCCTGAGTAAG
AGCAAGAACCCCCTCTCTAAACATAGCTGGGCATTGTGGCAGGCGCCTATAGGGAGGCTG
AGGTAAGAAGATCACTTGAGCCCCAAGAGTTTGAGGTTGCTATGAGCTTTTAATACCATG
GTACTCTACCGAGGGTGATAGAGTCTCTGTCTCAGAAAGAAAAGAAACTAGACAGATGAT
ATTTGTAGCCTATGACGGTCTAGAAGCAAAACTAAAACAACTTATAGAATATATACTGAG
GACTGTTAGCAATACTCAGAATGGACCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved