Otolemur_garnettii Locus Mono:303:SNORA72
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:303:SNORA72
Otolemur_garnettii
Mono:303:SNORA72
GeneScaffold_2933
SNORA72
1001..1110
2110
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGGCAAA
GTCCTGCTCGCATGGATCTTGCATTCTAATGGGGGAAACACACAAAGAACAAAGTTGAGC
AGAAAGGAAATCGGTACATCCAGAAAGTGATACAGGCATAACTTGGGCACACTGTGGGTT
CAGTTCCAGAGCATTGCAATAATGCAAACACTGCGATAGAGCAAGTGATGTAATTGTTTC
GGTTTTCTAGTGTGGATAAAAGTTATATTTACACCATTCTATAAAGTGTGTAATAGCATT
ATGTCTAAATAAGTACATATATTAATCCAAAATGTTTTATTATGTGAGTATTCTCACTGT
TCTGATTCTGTAATAATTAGGACAGGCAAAACATTTGCTGTATTAAGACAACACACATGT
CCATCTAGCTTTATAAATACTGGTGAAAACCAGTTTAAAAAACTTTATTGTTAAAAAATG
CTAACAAAGTGAGCTACAGAAAAAAATAAAGGTGGTCACAAACCTTCAATTTGCAAAACA
TGAAGCAACTGCAAAGTGCAACAAGGTGAAGTGCAATAAAACCAGGCCTGTAAGTGCCAT
GAGAGGAATAATTAAGGACACTGCACACCCACCTCTGCCAAAGTCCTGCTCCTGCCCTGT
TCACTGCAGCTGTCACTGATCACCCAGCATGATAGATTTCTTTTCTCTTTCAACTTGATT
CCTTCTGCTTTTGTAGCACTTTGTTCCTTCTGCCTTCTTTCAGTGGGTGGGGTGATGAGA
TACAGTCTCTTGCTCTGTCACCCCAGGTAGAGTGCAGGCCATCATCATAGCTCACTGCGA
CTTCAAACTCCTGGGTTCAAGGATCTTCCTGCCTCAGCCTTCCAAAGTGCTATGATTATA
GGCCTGAGCCACCATGCCTGGCCTATTCATTTTTTTTTATCTCTCCTGTTCAATTGTAAG
CACCTTGAGGACAGTGGCTGTTTTCATGTTTGGATCCCCCCCCCCCGGCCCTGCCCCAGT
GCACAGTGCCCTATTTATATGAGTGCCCTTTTTGGAAAATTAACAAGTTATATTTTCTGG
TTTTTCTTTTCCTTTGCTTCTCAGGACTTTGCATGAAACACGATCACTGCTGCTGAGGAA
TCCTTTTGCTCCTGCTGAGTTCCCACCTGCATCTTCAACCTACGTAGGTGACAGCAACCT
CATTTCATTTGGGATAAGATGAAGGGCCTCTGGTATTGTGTTCTTGACCTCATAATGAGA
ATTACCAGCAGGACTGGATGGATTCCTAAGGAACATGAGCCTGCTGTCTTGCAAATGTCT
TTAATAATAAATGATGAGAAAGGCAGACAGTACTATATAATTATTTCTTTATTATAGAAA
GTCTCTGTAGACTTTCAGTGTCCAAATTTAAACTAAAAAAGAATAAAAAGGCATAATTTT
GGATCTTCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved