Otolemur_garnettii Locus Mono:261:SNORD116
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:261:SNORD116
Otolemur_garnettii
Mono:261:SNORD116
scaffold_38418
SNORD116
1001..1091
1313
TTCTGAAGTAGTCATGTGTTTCCTCTGTCCTGACAAGTGGTGAGTCACAGCAGAAATAC
CAAAGGCCAGGTGGAAACCAAGTGGCTAATGTGTGCTAACTGGAAACACCAGGGATCCCT
TCAATGCCTGCAGCGTGGCAAAGTAAACAAGTGATTGTGAAATTAAGGGGCTGTTTCCCC
AACACAATTACTTTCCTAATATTCCAGGCCACAGAGCTTGCATGGATTAATGATGACTCC
AAAGAAACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCATCCTCA
TCAAACTGAGGTCCATCATGTGGCTCCACCAGGGAATAGAGAAGGAGGGATTCATGTGGG
TAGCACCATGGGGTCACTCTGGGCATTGGATGTGGTCCATGTTGTGGGAAAGCAATCTTC
AGTGCATTTGGGAGCCTCCCAGTGATGGGATGGACTGGTCTTAGGAATGTGTCCTGGCAG
AGTGGGGAAGCACACTACCATTCTGTAGTGTTTAGTTGAGTGTACATGGTTCGCTGTCAG
AGGTAGGCAGTGGCTTCCCTCTGTGCATATTGCACCACCAGGGTTGGGCGGTAGCCTGCC
TCTGAGCATACAGGGTGGTTACTGCAGTAGTGTCACTTAAGCCTTTCATACCTCAGTGTA
AGATGGGTCACTGTGTTCAAGCATAGAACCCAAGGCCATGGCTCAGACATCGTTTGTCTC
TGGTTTGTCCTTGGGTGAGGATATTGGAGTGGCCATAATAATTGTGCAGAATCTGTGGCT
GGTAGTAATGGGGAGGTTGGGGTCAGTGAATTATGTTGTTAATTAATAGGAGTCTTCAGA
AGGTGTCCATGTTTTGCTCACATGTGTACCATGATCACACAAATTCCAGGGCAGCTATTT
ATTTCACTGGGATGGAAGGCAGAGTGCAATGTGTGGAATTTGCTAGCCCTCCATGGGAAC
CAATGAGTATCTGTCTGCTTTGAGCATTGGATGTTCCCCATAAAGTGGGGCAAGCCATGT
CGGAGCAAGGGGCAGGGGTGGAAATGTGATACCCTGTCCATAGGGGAGGCAATGTTCCCC
AGATTACCTTGGTTTCTTGAAGGTACCCCTGCCGGACCCAGATTGCTAATTTTCTTTGCT
GGTGGTATATGCAGTCTTAGTGTAGGCCCAGAAGTGCTTCCAGCCAAGGTTGGGTACAAT
GCAGGCCAGTGATTCTTGCTTCCTTTGTCCATTGGATCTCGAGATGATTATGTATCATAT
TTCTGGGGCCATTGCCTTCCTAGAGCATACACAGCTAAGGGCATTCCTTTCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved