Otolemur_garnettii Locus Mono:254:SNORD26
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:254:SNORD26
Otolemur_garnettii
Mono:254:SNORD26
scaffold_83611
SNORD26
1001..1074
2074
ATGAAATTGTTCAATTTGCTGCATTTATTGTACCTTTGTTTAGACTGTATCAAAAAGAT
TTCAATTATTTGTGGTCAGATCCAATGAGTTACTTTTCAATTTGTATGTACATATATATG
TCCATAACATTGAGTATATAGAACATATTTTAATATGTTTAATATATATAATGTTTCATT
AACATGTCCTTACAACTTACTTGCGATAAGATCCTATTACTTCAGGCAACAGATGATTGA
GACTGTTGGGTTGTAATAGACAAAATTGCTTTGTTTATAAATACTTATCTCTTCTGTATT
AACCAAGCCATGGTGTCGCAAATGTTTTTCAGTTGCACTAGGACTGAATTGTTTTCTACC
TTCTATGACATTCATAGAGTTTACAGTCTCTCTCCAAAGTTTGTTCTTCCTTTTCTGGTT
TTCTCATACAGGCTTATGCCAATTTGGTTCATACCCCATGGGATAAAATAGTTGTTCTGG
AAAGTTATATTTGCCTTTTTAAGACTAAAACTTTCTAAGTAAAAAGGTACAAAGAACAGC
TTACAAGGTAATTTTCTGTGGCCACCAGTTGTTTTTTAATATCTTCAGTGATTTTTTTAG
GACCCTAAAATTATTTATCCATTTTGGAGGAATGAGCTGGAAAATCTAGACAAATAACTA
ATTTTTATTACATATAATCTTTTGAATAAATTATGGGTCCATTGTTGAGTTTGACTCAGT
GGGATTAGAGATCAGTCTAGCACTGCCTGTAATCAGGGAATAGCAGAGGAACTAACATGT
GTGGTTCTCCAGATTTCTACCATTTGTCACTTCCTGAGGAACCTGTGGGTGTGCTCTGGG
CAGGAGCCTTTCCTCCCAACCTTGGCATTCTGGGGCTGTGAACCAGTCCTGCTGCTGCTG
TTTCCTGTGGCTTCTTAGGCTGAGATTTTGAGATCACTGTATCAGTGAGGATGCTTTTAG
ATCCCCAAGTCTGAAGCTTACTTGTGCTACTTCAAGCAAAATCGGGAATAGATTTCAAGA
GTTGAACTCTTTCTTTCTGATAGATTAGTGGAGAAATCACAAAATTCTGAGTGGCACTAT
ACAGTGCAAATGTCTGGGGGCTTGGGTTTTAAGTTCTGAGGGGTTAATGATGGGTGCTAT
TTTTTCAGATATTCAACCTAAAGGAGCTTAGTGCTAGGAGAATGGGACAAGAGCCATCTC
GCTGCAGAGCCAGCATTGCAGTGATGGTCCAGCATCTCATAACTTGTCTGAGGGATTTAA
CTGCCTACTGGGGAAAACACAGGTCATGCCCATGATGATGATGTATTTCTCTACCTTAGC
ATGTCCACTGATTTGTGTAGGGTCCAACTCATAGGAAAAGTTGAGGGTGGAGCAACTTGT
TCCTATGTACAATTGAAAATCCTTTAGAGCAAAGGTGTCCAACCTTTTTTTTCTCTGCCA
TTCATTGGAAGAATAAGAGTTATTTTGGGCCACACATTAAATAAACACTAAGGAAAGCTA
ATTAGCAAAAAAGAAAAGGAAAAAAAAAAGATCCCTGGATATTTTGGACTTTTGTTGGAT
ATCAGACACCACAGATGCAAAAACGTCTTCGCAAAAGCAGCATGCAGCTCACTTACTGCA
GGTTGGAGACACCTGCTTTAGAGTTACCCGTTACTAGCTAGTTGGTTCAAAGCTCCAGTA
CCTTGACTGGAACCCAAGAATAATTTGAGGGAAACTGAGCTTGTTTTTATGCAACTCCAC
GCTGAAATTTGTGGTCTGAGGAAAAAACAAGGTGCATATAAAAGTGAAAACAAGGGCTGG
CCTTGAGATAAGCAGTATTGAAACAACTGCTGCTCACCCACCAGCAGATCCCTTAGTCTA
GCCATAACTACGGCTTTAATGGGGCAGGAGGCTGATTCAGTAACACTCTCCTACCAACCA
TGGATGGCTGTGAACATAAGTGCATCCATGCCCCTGCTTCCCCTTTTGATGTGTAGAGCC
TAATTGTAATACACTGCACCACAAATTCCTACCCCCAAGTTTATATGGGTCATATGCAAT
ATGTAGCAATAAAGTTCTCCTTTTCAACAGTTATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved