Otolemur_garnettii Locus Mono:249:SNORA26
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:249:SNORA26
Otolemur_garnettii
Mono:249:SNORA26
scaffold_80980
SNORA26
1001..1122
2122
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCCTGGGCTTAGGTGATTCTCTTGCCTCAGCCTTCTGA
GTAGCTGGTACTATAGGCGCCACCACAACGCCTGGCTATTTTTTTGTTGCAGTTTGGCTG
GGGCCGGGTTCGAACCCACCACCCTCGGGTCATGGGGCTAGTGCCCTACTAACTGAGCCA
CAGGCTCTGCCCACCAACCTGAATTTAAAACAGATTCCCTTTGTCTCTTTAAACATAACA
TGCTGGACTACAAGCAGGGGCAATTCATTACCAAGGAACATCCGTAATGCCCAGTTCTAG
TAAAAGGAGCCAGGGCTCCTTGGAAAACTGTTATTACAGGAATGGGGCATTAGAATTTCA
AAGGCTACCAGGCAAGGTAAGAGGGTACACGGCCCTTTCCTGTGCCCTTTTAAGGCTGAT
GCAGTGCTTTAAGGGAGGAACACAGAAGTATAAAGTGAGTTTCCATAAAACCCAGGGAAG
AGATTATAAAACTCTTCTTTGGATCCTGTCTGGAGTCACAGCTAAAGGAAAAAAAAAAAA
AACACAACAAACAATAAATTTTTAAAGGTTACTGCTGATAAAACTCAGGATAACTTTAGC
ATTAGAAAAATAGAACCACAGCTCGGCACCTGTAGCTCAGCAGCTAGCCAGCCACATACA
CCAGAGCCAGCAGGTTTGAATCCAGCCTGGGCCTCCCAAACAACAATGACAACTACAACC
AAAAAATAGCCCGGCGTTGTGGTAGGCGCCTGTAGTCCCAGGTACTTGGGTGTCTGAGGC
AAGAAAATTGCTTAAGCCCAAGAGTTTGAGATTGCTGTGAGCTGTGATGCCACGGCATTC
AACCCAGGGCAATGGCTGGAGGCTTTGTCTCCAAAAAAAAAAAGGAAAAAAAAAAAATAA
AAGAAAAATAGAACCAGGGCGGTGCCTGTGGGTCAAAGAAGTAGGGCGCCAGCCCCATAT
GTTGGAGGTGGCGGGTTCAAACCCAGCCCTGGCCAAAAACTGCAAAAAAAAAAAAAAAAA
AAAAAAGGAGAACCAACATATGAAAAAACAGAAAGTTTCAAAAAATTAATAAATAAATTA
AAATAGAGAAAAATAGACCCTCAATAGATTGAAACACATTGAACATAAAAAAACTCCATG
AGTTCAAATGATACTCCAAAAAAAAAACCAAAAACCAAAAAACAAAAAAAAAACTTTCTA
GTTAATTTAGAAGTGCTTAGGAAATCAATTCATTATCCTGGTATCCATAAAGGGAAGGAA
TCCTGGATTTATCCTGCCTTTCCAAACATGAGGTGGATGTTTCCCTGTAGAAGAAGCATT
GCTAATATATGACAGAGGAACCAAGACATTAGAATACTACGTAACACCATTTAGTAACCC
CTAATGAAATCACCATTCCAGGCAATGATTGTCAGTGTCTGCGGCAACTGTTGAGTGAAA
TGTCAATAGGGACCTTTATGACAGATGGGTCATGTCGACACATTTGAACGCACTAATCGA
TTTTAACATCACTAAAATCAGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved