Otolemur_garnettii Locus Mono:329:SNORD23
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:329:SNORD23
Otolemur_garnettii
Mono:329:SNORD23
GeneScaffold_1631
SNORD23
1001..1112
2112
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTTGCGGCGGAGGCGACGGCAAGCACAGCGGCTGGCTGAGGCCAACAAGCCCCGCAGGC
TGGGGCGGCTCAAGTGAGGCCCGGGCTGGGGATCTGGGGGAGGCTGGGGAAGGGCCCAGA
CTCCACATCCTAATGCCTTCCTGCCTTTGGCCAGGAGGCCTCTCCTGGGAGGTACCCCAA
AGCTCTAGGTTTTCAGAGGCCCAGGCTTTCCCCAGGAGGGAGGTTTGGACTTGGTGTCCC
TGACCTGTCAGGGGCTAACTCCCCTTACTCCGAATGCCCCTCTTTCCTCTCTAGGTATCA
GGCCCCTGACATTGATGTGCAGCTTAGCTCGGAGCTGTCCGACTCACTCAGGACCCTGAA
GGTACTTGCTGTCCAGGGCAGTGTGTTGCTATGGGGGCCCGTGCCCAGTGATGATACCCA
TCCTTGCTCCCCGTGCCTCCCAGGGGCTGTGGGCGACACCATGGCTGCCCCCAGGACAGG
CTGGTTGGGCTATTGGCCTGGGGGCTGAGGGCACGGGGTCCTAAGTTGGGGTTCCTGGGA
TGAGGGACTGGGTGGTATTTGGGCCTGTGGTCCTCAGAAGGCCTTTCCTCCTAGCTTGGT
CTTTACTATGGTCTGGTCTCCTAGTCCTTATCTCACTCTCCTCAGGACTAAAGAGATATT
CTACAGCTCAGTAAGGACCCTGTTCCTCCCCAGCTCAGAACCTGCTATGACTCCCCAGTG
CCCTGGATGAAGCCTAGCTCCTCCCCACAGCCAGGAGCGTTGTGTGGCCTGGCTGGGGCT
CTGTGCCTTCTCCCTCTGACCTTGTCTTTGCATGTTGTTCCCTCTGCCTGGCCTTCCCTC
TTCCATGCCTCACCAGCCTCTGTCCTTTGGATTCTTCCATACCCAGTTCAGAGGCAGCTG
TGGGTCATTGGCCATTGGCTCCCAAGACCAAGTGCCATGAACTCAGGGCCAGGCTTTGCT
CCTGACGTAGCACCAGGGAGACTGCAGGGCCTAAGCTCCACCCGGACGGCTGTGGAGTCC
AAGGCCCTTGGGCTTCTGCCAGCCCCTCTGAGGCCTCCTTCTCTGTCCTACAGCCGGAGG
GCAACATCCTCCAAGACCGGTTCAAGAGTTTCCAGAGAAGGAATATGATCGAACCTCGGG
AAAGAGCCAAGTGAGGGCCCTCAGGACTGCTGCAGGGGTTGTGGTGGTGGTGAGGGCATC
CAGAACCTACCACTGAGCTTAGCTAGGCCACCAGTCACTGATTGCTTTCTTGTCCCTTCT
CCAGGTTCAAGCGCAAGTACAAAGTGAAGCTCGTGGAGAAGCGAGCATTCCGGGAGATCC
AGTGAGTGGGACCCCTTCCCTGCCAGGGGGCGCTGGACTGGCTCTGAGCGGCTCAAAGTA
AAGAAAGGACTCCCTCTTCTGTGTGACATCCACCAGGTCCCTGGGTCTTTCCCAAACCCA
GCAGCTGTGGCCAGTGGTTGACCATTGCTCCCTTGGCATAGCCTAGGTGACAGTCAGCGG
CTCTGAACCCAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved