Otolemur_garnettii Locus Mono:306:SNORD88
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:306:SNORD88
Otolemur_garnettii
Mono:306:SNORD88
GeneScaffold_2654
SNORD88
1001..1094
2094
TATGGGGCTGGTGTCCAGCGCCCTGCTCACTGATCCACAGGTGCCACCCTTTTTTTTTT
CCCCTACAGTAGCCTGCTTCCTCCTTCCTCTCAGTAGGTTCTTCTGAGGGATTTGCATCT
TGGCACCTTTCCCTATTCAGGGTTACTAGCAGGTACAGCCACTGCTGAAAAAATCTTGTA
ACACTAAGCAAGGGAGGAATGGACATTAGGGCCCACTTCATGTAGTGGGTTTAGAAGCAC
TAGACTATGAGGACTATACCCTGTGCACCTGTGACTTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGTCACATTCTCAAAGGGCCTGAACTTGGGGACCCCCCATGATGTCC
AGCACTGGGCTCTCACTACCCATGAGGACACTGTGCCCCCCTGGGACCTTTGACACCCAG
GGGTCTGAGGGGCCCCACTTTAGGAGGTGCTGTGGGAGGTTGTGGGCATTCCCCATGCCC
AGCACCTCTTCTGTGTCCTTTCCACAGCTGCATCCCTCTGGGCTCTTGGCTGTCCCCTGC
CTTGGAGCAGCAGAGGCCATGGCTGTGAATGCTGGCACCAACCTAGGTGGCCAGGGGACC
AGTTCTACACCTTCTGCATGTTCTCCACATACACCAAGCTTCAAGGAGAACCCCAGACAG
CTCATGATAATCTGTATCCTGCAGGGGCATGATGGGGAACCATGCCCTGTCCCTAAATTC
CAGGGAGCTGGTGCTACTAACCTGACTTGTGACTCTTGTCTTCAACTACCACCTCAAGGT
CCCAGAGGGGACCTGGTGCCAGCGCTGAGTCCTTCCTGCCCCTTGGCCCTGGACTACCAG
GGAGGAGAGTGTCCAGCTAGATCTGTCATGAGCCACTCTTAGCCCCCTCATCTCTTGTCC
CCCTGTCCCAAGCTGCCTGATGATACCCTTTTTACTCAGTTGCAGCTCTTACTAGTCAGC
CTGCTAGTCAAGGTACAGGAGAGCTCAAAGCCATCACCAGAGGCCTGGTGGAGCCAGGCT
GCACCAGGCTCAGGCTGGCTCCTCTGGCACTATGTGCAGGGAGGAGGGTCCTGGAGCTGT
TCAAGGAAGAGGGACAAACCCCACGTCAGGTGACCAGGCCCAAGGGAGGAGCTGCACACA
GCACAGCCAGGGCTGGGAGGCCAAGTTCCAGTCGAGTTGGGGCCAAGCAAGTCAGTACCT
TGCTTGTGGGTGAGCCATAGACAGACATGTTCAAAAGCCCTAGAAGAAGGATGTCCTTGA
TTGCACCTACCCCTGTGGATTTCACTGGCCAGAGCCAATGGGAGGAACAAGCACTGTTGG
CCATTTATTGCAAGTCTGTGGGTGCAGAAATTTTGCGCAGAATTTTTTTAAAGGCTTTTT
GTTTGTTTTTGTAGAGTATTTTTGCTCAATGCTTTCAGGATAGGTGCCGCTTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved