Otolemur_garnettii Locus Mono:506:SNORA38
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:506:SNORA38
Otolemur_garnettii
Mono:506:SNORA38
GeneScaffold_5394
SNORA38
1001..1123
2123
GCCCTACTGACTGGGGAGACTTTACAGCACTCAAACTTGCTCTTACTACTCTCTACAGC
AGACAGGGCTGAGACACAAATAAGGGACTAAACATGACAGCAAAAGATAGACAATTACTA
CAAGAATGAACATCTTACAAGGGTACATGTGACATTTACTAAATGTAGAATACAAATGTC
TTAACACAATAACTAAGAAAATGCCGTGAAGGCTATGCCAACCAGTTTGGCAAAAATATT
TCAAATTGTATATAAAACCAGCACATTGGACCCCATGATTACATTAATGTAGATAGCTAT
GATTTAATAATAATTAAGAAAAGAATGAAGCATTCACTACAGATGAGCTACGAAGGAGGC
CTTTGTCAGTTCATCCTACTCTCCATCTAGAATTTTGAGAAATCTGTCGCCACAAACTAC
ACTGAAAAGCCCTCTAGTAGTTCTGGAGCTCAAGAATGTGCCTCATCTCCTTGATCTGAG
TCTCCTTCACCAACCCAACCCTGTATGAACAATACCAGTCATTTGGGGACCACTTACTAT
ATGCCGAGCATTATACTTAATTTAACATGGACTATAATATGAACGAGCAAGCCACACATG
ACAAATGAGGGTGCCCTCTGGTTAACATATCAAGGAACATAAGGACTCAAAGGGACCACT
GAACTTGGCAAGTCCAACTTCAATTTTGAAATGAGGAAGCTAAGGCCTCTGGCCAGGGCC
GTTCCCTGCCTCTAGCCCAACGCATCCTTTTCCTGGTTAATGTTTCTATGACCACCAGGT
TTCAGCTGTGGTCAACAAAACTTCTCCTCAAGAAGCCTTCCTTGATCTCCCCTCAACTGG
GGGGCTTCTCTGCCTGCCACCCCTTGGGAGAGTGGGTCTTTTTGCCGGCCTTTTCCCAAG
TAGATAGTACAGTACCCTGGAGACACGGTAAGCACTCAAATAGGTATATTTGCTGAATAA
ACAAAGAAAACCATCCTATTCCTGGCATTTTCCTGAAAGAAGCCCTAATTATTTTAGGGT
CAAAAATATTACATTTAGTAAGAATTGGAGGCAAAGAAATGAGGATTTGGAGAAGTCTGG
GGTCAGCTTACTCTCCACAGGTTCAAGATCAACATCCCACATAGAAAAATAATAATAATA
AATTTAATATTTAATATCTTTAAATATTAAAAATATTTAATATGCTTCTGTCAAGACCAG
AAAGCATATCTTAAGAAAGTTAAAAAAAGTGATTCACTTTCTCATCTAATATGAATCATG
CTTTATTAATATAGAATAAAAAGTATTTTACTCATTTTTACTACTGGTATAATTATTGCA
AGAAAGAGAGAGCAATGACTGTACTTGGGGCTCACTCCTCCACCTCTGTACTCCCACAGG
AACCTGTGAGTTAACTTTCTTATGGCACCTGGCACTTATCTGTCTTCCTCTCCAGAATGT
GAGCTTCACAAAGGCAGGGATTTCTACCAGAGTACTTGCCCTGTACAGTATCCGGCACCC
TGTCACTAAAGATATAGTGCGTTACACCCCAATCTATTAGATCCACTATATATTTATACT
TAATCCACCCGAACACACAAGAGTCCCTGTGAAGTGGACATTATCCCATTTTTTCAGAGA
AATTGATCCTAGGAAAGTTATACAGTTGATTCTATCTGGAACAGGAAGAGACAGTCCATA
TGTGACACTAAAGACAGGAAAGCATTACATCACTTTTGTATGTGAGGTCAGCCATGTTGC
TGGGGACAGTCTAGAGTAAGGACAGTTGGGCTTTATGTCCCAGGTCCTGGGACTAAGTTC
CTCATGATAACCCTAAGTCAGAGAGAATAACTTAAATAATTCTCCCTTGTTTAAGAAAAG
GGAGAATAGAGAAACATAAAAAGGAATACAGATAGGAAAAACTCAAAAAAAACTTTACTG
AACTAGAATTCAACAGACCACCAACTCTGCATGTTATCCTTGAATAGTCAAAACCAGAAA
GCATGAAAAAGGACTTAACTATCAAGTTAGATCAAATACGTCTCCTAAACTTTGTTTACA
AAGTCTTAAGGACTTTTACAGGATTTGTTTATTCTTAACTGGCATTAACTGGAATGTTCT
TCCAGAACAAGCACTTCATAAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved