Otolemur_garnettii Locus Poly:15:SNORA2
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:15:SNORA2
Otolemur_garnettii
Poly:15:SNORA2
GeneScaffold_3015
SNORA2, SNORA2
1001..1137, 1286..1423
2423
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAGATCACTCCTGAAGCCAAACACTAAGA
GGTTAACTGTGAGGAACATAAGACTGGCTTTCACAGGAAAACACACAAACACACAATAAA
GAAGTCACAGGCCAATAAGGGGTGGAAGCTTCATCTTTCTCTTCTACCCTTCTTCTAAAG
AAAGGATTTGTTATGTAAAATTTGGATTCTGCCAAAAGGCCACAATTAAGGACCAGGAAG
CCCAAAAGTTTCCTTAAAAGGAAGAAAAAAATAACAATACAATAACACAAAACCTAGAGC
AATACCTGAAAATCTGCCAAAGTCTACAACTGGAGGCATGATGTGACCCCTAAAGGCCTC
CTAGCTTAATGGACCTTGACTCTTGGGAACCTCAGCTGGCATCTAGCCAAGCCACACTGT
CCTCCTCTCCTACATGGCCCTGGTGACTGCCCTAAGCTTGAAACTCTCAGCTCCAGTGCC
TGGACACCTTCCTCATACCCCAAGGACAGGGTTGCCATTTTCATGCTTCCAGATGGCCCA
TTTTCCTCAAGGACATTTCTGTCGGCAGCAGAGAGGTCAACCTGACAACACTCCTCAAAT
AAATGATGAATCTAAAGCAAACAGATGTAAAAACAGACAACAGAATATTTCCTTCACTCA
TTTGTCACACCGGCCAGGGGAAAAAAGCACCCTAAAAATATGCGTTAGATATGTGGCAGG
ACAATTCTGAATTCACCTTCTAGGAGGAGCCTAACTCACTCTTGTGTTCATTCTTTTGTC
TTTTGTGTTGTTCTTTTACTTCTTGCAAAACCAACTCTTCGTTGGCCCTGAATCAAGGCC
AGCAGTTTGCTGAAGCTGTTGGTTTCAAGCAGGCACCTAAAGAATTATCTTTCTGGCTCG
GCGCCTGTGGCTCAATCGGCTAAGGTGCCAGCCACATACACCTAAGGTGGTGGGTTCGAG
TCCCCAGTCCGGGCCTGCCAAACAACAATGATGGCTGCAACCAAAAAATGGCCGGGCGTT
GTGGCGGGCGCCTGTTGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGACTCACTTGAGCC
CAGGAGTTGGAGGTTGCTGTGAGCGTGATGCCATGGCACTCTACCCAGGGGGATAGCTTG
AGGCTCTGTCTCAAAAAAAAAAAAAAAGAATTATCTTTCTATGGTCTGTTGGCCATTTCA
GAAGTTTGGAAATGTAATGGTCAATTAATTAGAAAGAAACAGTATGAGTCATTGGTGATA
GATGTAGGCCAGTATGTATTTGTAGTCTTAATACTGGGGTTCCAAAATATCTATAAATTT
TTTTTATATTTATCTTAAGAGAATATTTAAGTTATTCATTACAATTATAGTGCTGTTAAA
TCTTAATTATAGCTCCCCAAAATTACCTTGGGTTTTTACCCAAAATAAAAAGATAATTCC
ACAGTATGAACTTCCCTCTTCCCTCAAGTATTATCCTTTTGTATAGTTAGGGCCTTAACT
TGTATCTTTTAAACTTCATTCAAATTAGAAGCTTACTTTTTGCAAAAATGAAAAACAAAA
CAAAACAAAAAACCAACACTACAAAATCTCCCCACACAACAATCTTGCTTATACACTACT
TCTGCAATTTTCCCCAAAGCTCTCTGTTCCTCACAGGATCCTAACGTCTTAGTACACATA
ATCTGCCCCAATACCAATTTTAAGTCCCCATTACTCCCTCTCTATACCCCTCATTTCAGC
CAAATAAAAGGTCTCCCAAACGCTGATGTTCCTAAGCCCTTTTGCCAGAACCCCCCAGGA
GGATACACTGGCACCTTGCACACTCAGTAGGCGCTCAACTCTCTTGAAGGCTGACCTCCA
GACAGGTTCTCTGATGAAAACCAGTCAGGTAGACAGGAAGGAAAGCCCTGGCTCCAAAAC
CATCCTACCACCTAGTAAATGTCCCACCACACACAGCATTTAGAGTATCTAGTCACCCAA
GAACCTCACCCAAACTACAGTTACTGAGTTCTTCCTAAATGTAAACCCTTGCAAAAAACA
TAAAAGGTAGGAGGCACAAGTTACCACAGCTGAGTGTAAGGTATTGTGCAGGTACTTGGA
GTGCATGTCTCTATGTAAGCAGATATTTGTGAGCAATAGAAGACACAGGGACAGGACAGG
ACTTTACCAAAAGCCCAGAACATACTTAAGGCGTGTAACTTAACATCCATGCTACATGGA
AAGAAATTCACTTGGAAGTAGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved