Otolemur_garnettii Locus Mono:160:SNORA11
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:160:SNORA11
Otolemur_garnettii
Mono:160:SNORA11
scaffold_74685
SNORA11
1001..1116
2116
AACTCACCATTTTGTTAAACAATATTGAAACATATTGGGCTGGTTCTTAAGTTACAAGT
ACAATATCAAAGTTAGTGTTCTTAATCATCAAATCATTTGCAAACACGGTACACTTGTAA
AAATCCTTTTTGCTTTGTGACCAAACAAAAACAAATGATAGCCCAGATATGATCTAAAAG
CTATACTTTCCAAACCCTGCCTTAGAATTGAGGTCCTAAGGCTTGCCTTACTTCCTACTG
CTATTACAAAAATATCATAAAATGGACATTCTATAAGCAATAAAAATTCATTTGTCACAG
TTTTGGAGTCCAAAAAGTCCAAGATCAAGGTGCTAGCATATTAAGTAAGTGATGAGGGCC
TATTCCTCATAGGCAACAAATTCTTATACCCTCACGTAGTGGAAAGAGCAAACGAGTTTC
ATTGAGCCTCTTTTATAAGGACATTAGTTTCATTCATGAAAGTTCTACCCCTCTAAATCT
AAATATCTCCCAATATCATAACTTTGGGAGTTAAAATTTTAGCATATAATTTAGGGAGAA
CACATTGAAATCACACCAAAATAAACTGTAGAACTCCTTTAATAACTAGAAACTATTTAA
AATACAGTTTACAAAAGTATATAATAACTGAACTCTTATCTCTCCATACATTAATGCCCT
TTATATATTTTCCATCTCAGTAAATATCAATTTTTTTCTTGAGAAGATTTTAGGTGCCAA
GCATAGTGGTTCATGCCTGTAATCCTAGCACTCTGGGAGGCTGAGGAGGGTAGATCATCT
GAGCTCAGAAACTTGAGCCCAGCCTAAGCAAGACCGAGACCCTGTTTCTACTAAAAATAG
AAAAAACAAAGAAAGAAACAATAAAAAGACACCCTAGACAGATATTGTGGCAGGCGCCCT
TGGTTCCAGCCACTCAGGAGCTTGAAGTTAAAGGATCTTCTGAGCCTAACAGTTTGAGGA
CGCTATGTGCTATGATGCCATGGCACTCTACCCAGGGCAACAAAGTGAGACTCTGTCTCA
AAAAATATATATGTATAACACACCCAACAGGACTCTGGGGTCATTGTGATCAGGGGCACA
AAACTTGTGGCCTCCCTGTGAATAAATCTCTACATGTGAAGAAGAAGAAAAAAATGAGAA
ATGCATGTGGTGGGTGTATGGGTGATCACTGTATAATTTTTTCAAATGTACTGTATGTTT
AAAAATTTGCCTGATAAAATATTGGAAAATTTAAGAAAAGGAGAGAAGAGAATACAAAAG
AAGCTTCCAGGGGAAAAGAAAAAAGAGAGATAAGGGCTTTGAGGCCAAAATCCTTATGGA
TATTCTCCACATTTTTTTCTTTTACTCATAACCCATATTCAAATGATAAGGAATTTACAG
TGTTAAAGTATTCAAAATATATTCACAATCTTAGAACTTATTACTTCTATTGTCAATAGT
GAAGTCCAAGCCACCATCATTTCTCACTTAGATTATTTTGATAGTTCCCTAATAGATTTT
TCTTCTCTCACCTTCTTCTCCTATAATGTATTCTTCACACAGCTGCTGGGGTTATTATTT
ATAAGTCAGATTACATAATTTCGCTGCTCTGAATGTCTGATGGCAGCCTTTTTAATACTC
AGGAAAATATGATTAATGGTCTAGTCTTCTTCCCATCTCTCCTGCCATTTCCTTCCACAT
TGTCACTTCAGTTTTCTCTGAAATATGCAAGGGTTAATAAAGACAAATATGGGTCATTAT
ATAGTGGTAAATGTAGCAACTCAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved