Otolemur_garnettii Locus Mono:250:SNORA11
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:250:SNORA11
Otolemur_garnettii
Mono:250:SNORA11
scaffold_84258
SNORA11
1001..1128
2128
TTGGAAGGAGGAACACTGCCCAAAATATCTGGGGTCTGGTGTATGAAACATTTAAGAGT
AATGCGAAGAAAGGAGTAAACAGGGAGTTACATGCCAGGTATTTTCTGATATCCAAATCA
CGCCAAATACTGCAGCAACGCTAGAATTTTTAATCTGTAGATACACCCTAAAATATAAAT
TGTACCTCTACAAAACAGGGCATTGCTACACAGAATAATCAATACCAAATTCAAGTTACG
TGCATAGTAAGACACAATAGGTCTCTGATTATGCGTGTGTGCTCATGAGTAAAAAAATGC
ACACATTATTCTGTCAACATGTGAAAAGCATCACGACACTAAAATCTGAGAAGGGTTCAG
GTTCACAAAGGACCTGGATGCAGGAGAGACCACTGACAAGGTCAAGTGCAGATCTCGTTT
TTAAGTAACTTACAAATTTCATAAAAATTAAATATGGAAAGAATAACTTGAAAACGTTTT
ATTTACCACATCAGGCTTAAAAGTAAGGAGTCTTTAAAAACATTTCCAAGCCACTTATAG
ATCCATGTGCCTGACACAGGTATTGATGGGAGCAGGTTCAATGCCTTGGTGCCTAATTCA
AGAGTCTACCTGGTTGTCCAAGTTCATAATGAAGGGAAAAAACCTCTATCATTCCAAACC
TTCTGGAATCTATGTCGAACCACGTACCCTCTTTCAGAACTCGTACCCTACGTACGAAAG
GGAACACAGACATCTCTGTCATCCTTACTGAACCATCCCTCGCTCTTGGTTCACCTCGGA
TCTAAGTTATTTCCATTCCTATTTTTACAAAGCACAGCATGAGTCGTCTTTTGGTCATTT
ATGCAGCATGAGCTCCATTAGATCATTTATTAGATTATTCTGATGTATCCTAACAATTAC
AAAAGATTCACACTCTTGCTACAAATCTGCACGGTATGTTTTAAACATATGAGAATGTCA
AAGTTATATGAACATATTTTTTCATCTAAAAATGTGTATAAAGGGTCTGCTCTGAACAGG
GCCTGAAGAAATGTCTTCTCCATCTACAAGACACCCTACAGCAATCTGGGGTCATTGTGA
TGGGGGGCACAAAACCTGTGGCCTTCCCACGAACAAACTCTCTACATGTGCAGAAGAAAA
AAATTATAAAATATATCTGGTAGGTGCACGGGCGATCACTGCATAATTTTTTCAACTGCA
CTGTATGTTTGAAAAATCCCCTAATAAAATATTGGAAAATTTAAAAACAAACAAATAAGT
AAATAAGCATAATTTCTCTGATTTAAATAATTCATATGAATCCCAGACAGTAAATGTATG
TATTTATGCACAAGAGAGTTTTATTATAGACAAATCATATGAAGGTCAGACAATTACGTT
AGTCAACTCATCCCACGGTCACCTCCAAAGTCCTTCCCTTGGCCATCTGTTGACTGCAGT
GATAGTCAGCAATGAGGTCTGTAGCCACTTTTTCCAGGATAAGTTCACAAACTTAATTGT
CAAGCCTCATATGACAACAGTTCTGATGGCCACTCCAGAAAAACAGTTCAAAATTGCTTT
GAACGGGGAGGGGGGTGGCCAGGTGGAAGGAGGGTAATGGGTAGGACCTCACCTACCGTG
CATATTGCAAGGGTACATGTCAAATCTATGAAGAGTAGAGTGTAAATATCTAAACACAAC
AGTTAAATAAGTGAGGTGAAGGCTATGTCAACCAGTTTGATGTATACATTCCGAATTGTA
TATAAAATCAGTACATTGTGCCCCATCAAGGCAGTAATGTACACAGTTATGATCTAATCA
AAATAATTGCTTTGAAGGGTGGACCAGGCACTGGCATCAGGGCACAGCTTCCCAAGCGGA
GTTACTTCAAAGGTGACCAGTGTGACAGTCAGCACTGAGGGATGTAGCACTTTTTTCTAG
GACAAGTTCACAAACTTAAATTGTCTGACCTTATGCATCATCCCTAGATTTAATATCAGT
AAATATCATACTATATCACACCTAGATAGAGTAGCCACTGAAATCCTGCCTGTACACTGG
TTTCAACAAACCTTTCATTATTTCATTCAGCAAATACATAACAAAAACTATGTCCCTAGC
ACTATGCAGAAGATTACAGTGAACCAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved