Otolemur_garnettii Locus Mono:390:SNORA11
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:390:SNORA11
Otolemur_garnettii
Mono:390:SNORA11
GeneScaffold_516
SNORA11
1001..1132
2132
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCCCGACAAACGGCATTTAGGAAGATGGGTTTTCTCATCTGGTCTCCTCAGT
GTCCCAGAGTCTCAGAGGAGCCTGCTCTGTCCCTGAGAACTCTTGTCAAAGTTTGACATT
TATACACAGTTTGATGTCTGTCTCCAACTGGATTATAAACTCCACGAGGATAGAAAGCTC
CTCTGTTCTTTTTCCATCACTGTTGCCTCAAGCATCTCCATGTTTGAGGTATGTGCACAC
ATGTGCTCACATACAGAAGCCTTCAAAATGGTACACTGAGTGGAAAATAAATTCCAAGCT
TGTCCCTTCCTCCTTACTAGTATTAAGACATGCCCTGAGTCATTCAGCACCTCAGGGCAC
TGAGAACAAGGTCAAAATCATCAAATCTTGCTTTGCATCATGTTGAAAGAAATTTTCCCC
CTTGGAATATCTTGACATTGTGCTGAACGATTTTTTTTGTTGGAAAGGCAGGCAGGATGG
GAAATAGCTACCAGTGCTTCAGCACTGCCGATTATTAACACAAAGTAAGAGAAAAAGCAG
CTGTTATTCTAAGTATCAATGTTAGTCCCTTTACACACAGGATCTAACTTCATCTCTATT
GGAGCTATATTAATAAACTTATTTTTAGCACACCTGTTCCACAGATAAGAACGAGCAAGG
TCTTGAAGATGGTAAGTGGCTCTGTTTTTCACACACCCAACAGGAATCTGGGGTGCTTGT
GACAAGGGGCACACAAAACTTGTAGCCTCCCTGTGAACAAATTCCCTACATGTGAAGAAG
AAGAAAATTATTAAATGTTTGTGGTTGGGTGTCTGGGCGATCACTGTATAATTTTCTCAA
CTGCACTGCATATTTGAAAAATGGCCTAAGAAAATTTTCAGAAAAGTAGAGAAAAAAAGA
AAGAAAGAAGATGGTAAGTGGCATAGCTAAGTCTCAAATCCAGGTCTTTCTCTGAAGATG
CTCTTTCCATCATTTATAGTTGACCTCTTTGTGGGCTGAGAAGGTAAGAGTTATGATTCA
ACCCCAAGTATTGTTGAGATATTCCGACAAAGTCCTGAAGTATTCTAGGCAAACTTGGAG
GTTACTAAAAAGGCATGAGACCTTATTCCTGCCACCCTAAGATCCAGAGCCCCGGTAGGT
TAATAACGTTGGTGATGAAAATATCATTGATACATTTGTAGTAAGAACAATCACACCATT
GGAAGGCTCTCACCATGTCCTTGCCACTGCCTTAAATATTCTATAAATGTAACTCCCTTA
ATGCAACCTACAGCTCCATGAAATAGGCACAATCCTGATTTGATAGATGAGAAGCTTCAA
GCGCCTAAGAAAACCATCTCAGGTCACTCCAAGGTTGCATGATGACATCTGTACCAATCC
AACTCGGATACCGGAGCCTAACTTTATGACCACTATTACTTTTAATTTTTTATTTTCAAA
TCATCATAGATCTACAGAAGTTTTAGCAAATGCAGAGAAAGGTCTTCCTCCACGTGTCGC
AAGGATAACCTTTGACATAATTGTAAGACACGGTCAAGACCAGAGCGTTTGGCTGTTGTG
TTTTGCTATCGATACCCCTCTGTCACCACCATTGCCATCTATCCCTGAGTGACAGCTGGA
GCTACCCACCACTGCCACAGATAGAGTTGTATAGACAGAAGGGCAGATGAATGAGTAGAA
AATTGAACCATGCAAAGAAACGCTGGTGAAAACTGTTGTCATCAGAGAAAGGACAGAGAA
ATGCATTTTGAATTATAATGCAAGGAGGATTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved