Otolemur_garnettii Locus Mono:230:SNORD105
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:230:SNORD105
Otolemur_garnettii
Mono:230:SNORD105
scaffold_80573
SNORD105
1001..1074
2074
CTCTCCCCTTGTGAGTCCCCACCTCTATTAAAGCTATAGTTTCAGTGCAACTGCCCCAC
AGCTCATAAGGTGCCCCACCCTAGAAAAATTGGCCAAATGCTCTGGATTTTGCAGCAGGT
AGTCTTCCAGACCACCAGGAGAGGGGAGGGGGTGGATTGGGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTCAGGTTTATCCAGAG
AGTCCAATCAAGTCTTGTCTGTTCTAGATTCCCTCCTCCCCCGAGTGCTGGTTAAAGGCA
AGCCTTGAATTGTTGAAAGCAATTTCCATAACTTAACAGCATGCAAGAAGAAAATATAAC
TCTAAAAGTAAGTACAGCAAAATCTGTCAACTAATGATGTGTACGCATTGTGTAGCATCC
AGTAAAAACATTTAGGCATGTCCTAAAGCCAAAAAATATGATCTGTACTCTTTTTTTTTT
TTTTTTTTTTTTGAGACAGAGCCTCAAGCTGTCCCCCTGGGCAGAGTGCCGTGGCATTAC
AGCTCACAGCAACCTCCAGCTCCTGGGCTCAAGCGAGTCTCCTGCCTCCGCCTCCCAAGT
AGCTGGGACCACAGGCGCCCGCCACAACGCCCGGCTATTTTTTGGTTGCAGCCGTCATTG
TTGTTTGGCGGGTCCGGGCTGGGGATTCGAACCCGCCACCTTAGGTGTACGTGGCTGGCG
CCTTAGCCGGTTGAGCTATAGGCGTCGAGCCATGATCTGTACTCTTATGATGAACCCATT
TGCTTCTGAGCTACTGTGATTTGTCATTAAATTTAGCCTTTTAATCTGTAAAGGCAAAAG
TGGAAACCTAATATACACATGTATAAGTAAGAAAATTAATAAAGAAAAGGAAAAATATGA
TCTATAATTAGGAGGCAAAAATTAGTAAAATAGACCTAGAGCAGAAGCTTGAAAGGCTAT
GGTCAGAGCATTTTCCCTCTCACAGCAGAGACTCTCCTCTGATTTGTCATCCCCTAATCC
CCTTGCAATAGTCCTTGCAAAAATAACTTCTCTGCCAAGGGTGGTGGCTCTCACTGTAAT
CCGAGCACTCTGGGAGGCCAAGGCGGTGGATTCCCTGAGCTCAGGAGTTTGAGACCAGTC
TGAGCAAGAGTGACATCCCATCTCTAAAAATAGCTGGGTGTTATGGTGGGCACCTATAAT
CCCAGTTACTCTAAAGGCTGAGGCTAGAGGATTGCTTGAGCCCAGGAGTTTGAGTTTGCT
GTGAGCTATGATGCCACGGCATTCTACTGAGGGTGACAAAATGAGACAGTCTCAAAAAAC
AAACAAAAAAGCTCTACCCAAACCCAACCTTCTCCTTATGCAAATAAATAAGTACACAAA
TAAGAAAAAAATAGACTTAGAGATGGCAGAATTAGCAGACAAAAACACTACATAGATAAC
AATTTTGGTCTTAAGTTTAATATAGAGAGACATATGATAATGATGAGGAGAAATATTGGA
AGATAAAAAGAAGATAAGAGGCACCTCATACAAAAAAATACATCTAAAATAAAAAATACA
CAGGTTCTCCATTCGTGTTCATAGAACTGTATCTCTATTTTTGTGCCAGTGCCATTCTGA
TTTGATCACTATCCACTTATAGTATGAGCTTAAAGATTGGTATAGTGTCCCAGATTTGTT
TTTATGTCTTAGAGTTGTGTTGGCTATTTTTTTTTTTTGTTTTTGTTTTTTTTCTGATTG
CATATACAACAAAGAACTATTTGCTCAAGTTCTTCAGAGTATGATGTTGGTGCTTTAATG
GTGATTCCATTAAACCTGTAGGTGACTTGGGGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved