Otolemur_garnettii Locus Mono:369:SNORA74
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:369:SNORA74
Otolemur_garnettii
Mono:369:SNORA74
GeneScaffold_1527
SNORA74
1001..1195
2195
ATTTAAAAGTGTGAGATTTATTTTGAGACCCAATAGAAGGCATTTAACATGTCTATGAA
TACGGTCAAGCTAGAAAAAAAGGAGTCATCTTCTGAAATAGACTATTTTTAGAGCAGAAT
TAGCATAGAAAAGAATTGTGTTGCATTACATAAATAGCTCTTCCTGGGAGCATAATGATC
AGTCTGGTTCTCCTATTTAAGAAATCAGCCAGGAAAGATTGGAGAAAACTATTATACTAT
CAAAAATAAATTTTCATACTGGTCCAAGGAACTAATAATNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGGGGAATGAGTCCC
AATCTTAGTGGGTATCCAAGGTGTCTCTTCTTATCCCACAGGACCCTTGTTCAAATTCTG
CCAGTTCAAATGGAGGTTATTTTCATTCTGACTCTAACCCACACTGATTCTCATATATTG
AATCATGTCATTTCACTTTAAGGAAGTGCTAAGTGCCATCAGTGAAACAACTGAACATTG
ATGAGTTCCAAGAATTGAAACACACAGAATAGAAAGAATAATGAAATCATTCATAGAAGA
GGCCATTCACAAACAGCTTAGTTCCCGCGTAGTAAAAAAAATAAAGAACAAACTGGAGTG
AAAGGCAAGTGCAGCTCAGGATTCTGGATTTAAAAATGTTACCCAGCAGTTGTCAGCCCT
CCAGGCTCACGTGATGGGCTGCAGGGCTGATGCTGCACCGTTGGAAGAGCCAGTGTTGAG
GTTTGGCTCCGATCACTGTTTTGGTGCTGGGCAGAATACCTTTGGACAATGTTTTCCACC
TCCAAGAGTGGAAAGCCTCCTCCAGAGGAGTTGGTCCTAATCTGAGTATAAACAATTTTT
TTTTCTGTTAAAAAAACTAAAGAGTTTTGGCTCGACGCCTATAGCTCAACCGGCTAAGGC
GCCAGCCACGTACACCTAAGGTGGCGGGTTCGAATCCCCAGCCCGGACCCGCCAAACAAC
AATGACGGCTGCAACCAAAAAATAGCCGGGCATTGTGGCGGGCGCCTGTGGTCCCAGCTA
CTTGGGAGGCGGAGGCAGGAGACTCGCTTGAGCCCAGGAGCTGGAGGTTGCTGTGAGCTG
TAATGCCACGGCACTCTGCCCAGGCGGACAGCTTGAGGCTCTGTCTCAAAAAAAAGAAAA
AAAAAAAAAAACTAAAGAGTTTTAAGCTAAGTTTAATTTCTGGCCTATTAAAGTTCTCAG
TACAGGTTATTTTGCTTTAGAGATATAACCAAAGGGTGACTATTCATTCATTGCATTCAC
TCCACAAATATTTGTTAACATACCAGGCTCCATATTGGACCAGGCTCCTGTTCTAGGCAC
ATGGCATGTAACAGCAAGCAAACATCCCTATCCTCACCACAGAGACAGACAATAAACATA
GTGAATAAGGAAATTAGCTAGTGTGTTGGACAGTAATGGGAAATGAGCAGAGCTAGGTGG
ATCTGGCATGTGAGGAGAAGCAAGTTGCGACCTTAAGGATGGGCTTTGTTGAGAAGTAAC
TGTAAGGAAAGACTTGACAAAGGTACAAATGATCGGGGGAGGAGAATTCCAGGAAGCAGG
AACACCTGGTACAGAGTCTCAAGAAAGAAGGAGCATCTTGGCTTATTCCAGAAACAACAG
AGGAGGCCAGAGTGACTGGAGCATAGTGAGCCAGGAGGAAGGGCAAGCGGTCAGGCAGGG
CCCGGGGCTGTTGGAGGATTTCAGCCTCCCCGCCTTCCTATTTACACTCGAGTGAGACCA
CTTCTGAGCAGAGAAGGAACTCAGTTTGACTTCCATTTTAAAAGGGTCTCTCTGGCTTAC
CTGATGAAAATAAACAGAAGGGCACAAGGCAGAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved