Otolemur_garnettii Locus Poly:13:SNORA71
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:13:SNORA71
Otolemur_garnettii
Poly:13:SNORA71
GeneScaffold_887
SNORA71, SNORA71, SNORA71
1001..1134, 4550..4683, 6641..6773
7773
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCCAGAGGCAAAG
TCTGGACAACTGGCCCTTGCGCCTTGTCGTCCTAAAGTCTCTTTCTGGTGCTTTTTCTCT
GCCTAGGCCTTCTAGGCTATGGAGCTCTCCTGGGGGCCTCGGACGGCTTTGCCGGTTCTG
CAGCAGCCAGCGCCACCTGGTCTTCTGTGTCACTCTGATCTGCGCTCCCTGGTGGGCGCT
ACTGTCCCGCGTGTGAGGATGTTCCTGGGTAAGTGTTGCTTGTGAAACCTTGAAGGAAGG
GGGGTGCCCTCTGGGTGGCCCCTGCCTGGCACCAGCTCAGGCATGTCTAGGACCTGTCTG
GAAGGCCCTGGTGCAGGAGGAAGCCTGGTGTAGCAGACGGGGGAGCTGTGTTTGGTGGGG
CACATCTGGTTAAGTTCCTTCATTCTCCCCAGCTTGACTTCCTGTAGGGAAGCTGCAAGA
TGTCTGTGAGGGCAGAGACCTGGACTGTCTTGTTTTTGAACCTATAGTGCTTGTGTCAAA
GCACCAATATTTGCGGGGTGAATGAACAATTAAGGCATTTTCACCAGAAAATGGTCTTGC
TGTACACTCTTGATGGGGGCAGATGGGATCTTTATGTTGTGTTAAGTGGTGATAGCTCTA
AGGTCCTGGGCATTGCCGGACACCTCCCTCCCCACGTAGTTAGTGGGAACAACCCCGATT
ACTTGGGCTTTTCTTCCCGGCTCACATTTTGCCCTTTTCTGCCCTGCATTTGAAAGTGAT
CATGGGCTGCCGGTGCCCTGGTCATTGATAGTGCAGGGAGAGGAATCGCTGAAAGCATTT
CCCCGTGTTTGGAGGGCCCTCACCTGTCCCTTACAAACCCTGGAGCTTTCTCACACTTCT
AACTTCTCACCACTTTTTAATGCCTCCCACCACCTGGTATCTGGCTTATAGAGTGCTCTG
TGTGGGAAGTTGAGTGTGCCTGTGAGGCTTTTAATGGAGGAGCATGAGGTTGGGTTGGTG
GAATCTGGCCGGGGTGGGTGGGGTCAGTCTTTTATCCCCTCACTTCTTAGAATTAGTCAT
GCCCTGTGGCAATTGTTTATTTGCTTGTCTCTTTGCCTGTGGCTTCTGGGACCTTGAGGA
CAGTGTCTTGAGTCTTGCCTCTCATATTACCAAGTGATTGGCAGGTGGTTGATGTTCAGC
AATTTTGGAACAAATGAAAAACAGAAGATGGAAAAAGACTCACTGTTGCAAGGGTATTAG
GCTCAGCAGATGGTGGCATGTGAGGGAGATACTTAGAGCAAGGCAACTTGTGTAGGGTGG
TGAGAGCTGTTTCCCTCAGACCTAGTAATTCATCTCATGGTGCCACCTTGACATGGGACT
GGTGTGTGGTCCCCAGGATGAATTTCCCTAAGGATTGTCATAGTGTCAGGGAACAAAAGC
AGAGGTGCAGCTAGGCTTGGCTGATGTGATTGAGCAAGCTGAATATTGGCCCTTGACCCC
CAGATGAGCTACTCCTGCCCATAATGGTCCTTTGTGCCTACCTGAGACTCTAATATACTT
GTGTGGCAGTGTCCCAGAGTCCCATTCAATGTACTATTGAATGTGTGGCAGTGTCCCAGA
GTCCCATTCAATGTACTATTTCAGGACTACTGCAGATTAATCAATATACACATAAGCTGA
AAGTGGAGCCATCTGTGACTTAGACTGTGCACAGACCCGTCTTTAGACCTACTCTTCTTT
TCATGTCCCTGCAACAATAGACTGCTTTTCCGGTAATGACAGCCAGCTTTTGTGAAACAT
TTATCCTCTGGTGGCTTCTGAACTAGGTATTCCCCAGGTCCTTTCCAGGATGGGTTTGAT
TAGGTGATGTCTAGATTGCTCAGCCAGAGCTTTTTATTTTGCAGAGGAGGCAACTTGGTA
CAAAGGGGCCTGTGAGAGGTGTTGCAGTCCTGCCAGGAAGCAGCAGGACCACAGAACTCC
CAAGGTGAGTTCTGTCTTCTGGAGATCTGGGCTTTGTGTCCCACAAATTGCATGCAGGTT
CCCTGGGCATGATGTAGTCTGGGAAGTACATAGAGGTGGCTGCATGCTGGCCCCCAGTTT
TACCCTCTTTGGGATCATCAGGAAAACATTTGATTTCTCAGCTCAGTGCCTGTGGCTCAA
ATGGCTAAGGTGCTAGCCACATACACCTAAGGTGGCAGGTTTGAATCCAGCCCGGGCTGC
CAAACAACAATGACGGCTACAACCAAAAAAAAAAAAGAAAAGAAAAGAAAAAAAAATAGC
CAGGCGTTGTGGCAGGTGCCTGTGGTCTCAGCTACTTGGGAGGTGGAGGCAGAAGACTTG
CTTGAGCCCAGGAGTTGGAGGTTGCTCTGAGCTGTGATGCCATGGCACTGTACCCAGGGG
GACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAAATTGATTTCTTTTTATGTACCTTCTTA
AGTTTAGAGACTTTAGGGGGCTCTTTACATTGGTGTGTTGGCAGCAGAATATCTGAATCA
AAAGCAGGAAGGATTTTGGCATCAAATTCACCTGTGCCCGAGTCTCAATTACTTCCTTCA
CTGTCACCTCATAGCTAAGGGACCTTCTCTGGTCCTTGGTTTCCTCATCTGGAAAACAGA
AAAGGGACTATAATGAGGAGAATTTTCTTAGTTCACCCAGCCCCTGTCTTCCACATCTTA
AGAATTCTGCAGGCTCGGCACCTGTGGCTCAAGCGGCTAAGGCACCAACCACATACACCT
AAGGTGACGGGTTCGAATCCAGCCTGGGCCCGCCAAACAATAATGGCTGCAACCCAAAAA
TAGCCGGGCGTTGTGGCAGGCGCCTGTGGTCCCAGCTACTTGGGAGGCTGAGGCAAGAGA
CTCGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCAATGAAGCCATGGTACTCTACCCA
GGGGCTCAGCTTGAGGCTCTGTCTCAAAAAAAAAAGAATTCTGCAGCATTTTTATCAAGA
GGGTTGGTCTTTCCTTTGTCTCTTAGTTGGGCAGGTTAAGTTCATGCCGGACAAGGTGAC
AGCTGCTGTTTCCATCTCAGGCTCTGCAGACACTGGTCTTCAGTTTCAGCAAGCTCAGTG
TGCTTTTCTGCCTCTGCATTCAAAGTGATTGTACACTGCTTATCTCTCGGTTGTTGGTGG
TATGGTTGTAAGGTTTTCCTCATGTGCAGAGGGTCCTTTATTGTTCACTCCAGACAGGAC
AGCCTTAGAGGGGTGGCAGTGACCCAGCAGAGGCTAGAAAAGCTATTAGTGTGATGGCGC
CTGTGGCTCAGTGGGTAGGGCACTGGCCCCATATACCGAAGGTGGCGGGTTTGAACCTGG
CCCTGGCCAAACTGCAACAAAAAAAATAGCCAGGTGTCATGGCAGGTGCCTGTAGTCCCA
GCTACTCAGGAGGCTGAGGCAAGAGAATTGCCTAAGCCCAGGAGTTGGATGTTGCTGTAA
GCTGTGACGCAACAGCACTCTACCAAGGGTGAAAAAGTGAGACTTTGTCTTTAAAAAAAA
GAGAAAAGCTGACAGTGTATCCACCTCCTGAGATGCTGCTGATTCTCCTGGTGTTTTCCT
GTGGGTGAATGCAGTGGTTCCCTGGACGAGTGTTAAGCAGTGCCGAGTGTGTTGATTACC
TGCTGGCTTCTCATCCCTGCCGGAGCGTCACATGATAGTGCCCCATGTATGTGAGAGGTG
TCCTCAGGGAGAGCATAGATTGTGAGGTCCCTGGTAAGTGCTGTCCTGCCTGGTTCTCCA
GAGCTCAAGTTCTCTGCAGGCCTCAGAGCAGAGGTGGGCCAGAGGTGTTAAGGTGCTGTG
GCATGGGTGAATGAATGCTGCTTCCTTTAGCTCCCAGCTTTGTCCCCTTGGCTGTCAGAG
ACAGGAGTAGGCCGTCTTCTCCCCTCGTGGGGCTGCTGCAGAGAAGGTGCTTCCAGAGCT
TTGTTTGGGCTCTGAGGGTCCTTGCTAGAGGTCGCTGTGATGCTGAGAGAACAGCAGTGT
GCTGGGATGGATGGGGGCTGCCTTCTAGTCTCAAACCTAGATCCATATCCAGTGGCCCAC
TGAGTGATTTGTCATCGGGCAGTCAATATTGGTGCCATGCCAACCCAATCTTTCAGAGCC
CAAGGATTCTCAGTATTTCTGCCAATGTTTGCCTTCCCTTCAACTCTTGAGTGGCAGGTG
ATCTCTGTGAGCATCAGAGGCAGCTTCTGTAATCTTAGGCTGTAAGTCTGGTCATCATCC
GGGATGCAGGTACTGGCCTCCCTTCTCAGCATGTCCTCTGCCCTTTTCTACCCTGCATTC
GAAAGTGATCATGGGCTGCCCGTGCCCTGGTCATCGATAGTGCAGGGAAAGGAGTCGTTG
AAAGCCTTTCCCCGTGTTTGGAGGGTCCACTCCTGTCCCTTCCAAACCCTGGCGCTTTCC
CACACTTCCTCCTTCCTACCGCCTTCCAGTTGCCTCCTGTGCCTCGTGTGATTTTTTGAG
TTGCTCTTTTCTCCGGCCCAGGGCAGGTTACTGTTAGACATGTGGGAGCACAGGCTCAGC
CTACAGGAGTAGAAGAGCCGGGTGTGGAGCTGTGACAGGGCCACCTACCCCTTCCTCCTG
GAAGCTTCTGCTCCGCACCTCTCCTTCCACACCCTCCGTCAGTGCCCTGAGCAGCAGGCA
GACCCTGTGCAAGTCGTTGCTTGACTTGTCTCCTGACTGTCTTTGCCGTGATCTTGAGGG
CTATGTCTGAATTTGTGCCTGGTTTTGTTCTGTCTGTCAATGGTCAGTGCTCCACAGTGT
GTGACAGGTGAAAAACAAGAAAGGGAAGGCCCCTCCGATGTGGGGGGATAGGGCTCATTG
CATTGTACAGTGTTGGGGGGCGGGGATACCGAGTAAGCAGCCTGTGCAGGGGTTAAGGGT
GGGGGCAGACTGGGTGAGTTCCACCCCTTCAAAGAATTCTTCATCAAGTCACTGAGTCAT
GTAGGTCCTGGCCTTGTGTGGCCACTGGGGAAGGATTTTCCCTCCAGTCTGGGTATAAAG
GTAAGGACCAGAGAAGAATGAAATTGGGGAATCTATGGGATCAGCCCTAACAGAGCCCTG
CTGCTTCCCTAGGTCTGTGCCAGATGCAGCTAGGGGAACATGGTGCACTCCCCAGGGCAC
CATGGCCCCACTTGCTTTGAAGGAGCCCTCAGTAACACTTGGCATGACAGATAAAATGAA
TGTGCCGCTCCTGCCTTAGAAGTTCTCCAGCCCCTTCCCTAGAGGTAAGCTGCTTTTCTT
GTTCCTAAAAACTGTCTTGTGACTATTCAGATGATAATAGTTAAGTCACCATGTATGTAA
CACTGGCCAGAGAGGCTTGGCGACAGGTGTCGTCACACAGGAGACTGGCAGAACACGGGG
CCTGGGGTAAGGTTTCCGGTCCATTCTCTGGGCTTTTGACTTTTTGCACTCTCTAAAGTC
ATGCTCCCTTTCTCTGGTGGTTTGGGTAGTGACGTGGGGGGAGGTGAGGATGAAAAGAGA
GGAATGTCCCATGGATTCCCAGATCCAGACTCTCCCCGGGGAAGCCTGGGTCACCTCTGG
CTCCTTACGTGCCTTTAGGCGCTGCAAAGTAGGAGGCGCCTCTGGGGACTCAGGTGGGTC
GAAAGCACTGGCGCTTTTCCTGTATTAGAGCAGCAGCAGCCACAGGTTATTAGGGAAATT
AGGTGGGTTTGGTATTAGAGACACTGTATGTGGCCTGTAATTCTGCCTCTGCTACTGTCT
GGTTCTGTGACCACTTTCTTTCTAGTTGTAATCACTGGTTAAGATTTATCATAGCAACCT
AGCAAGGGTACACAGGTGACAGGTGATAAGGAGAAACAGACAAGTGTTAGGTCTGGAAGA
ATCCACGTGCAGCCTTTCTTATGCAGCCCCTTGGAGCCCACTCTTCCTCCAGCAATGAAA
ATGCATTCAACATAAGTTTCTGGTCTGGGGTGCCCAGGGTTTTTATTTGAGGTTGGTTGC
ATAGAGAGTGTATGCCTAGCATGTTCCAAATGCCAGGCATTCTGCCCAAACCACATTCTT
TGCCAGAGAATGAGCATGAGCTCAGTGAACTGCTCTGATCAGTTATCTGCTCACTGGAAT
CAATGACAGCCCAGTCTCTAGACACCAGCCAAGAGCCTCTGACCTGCTGTGGGGAACAAA
GCTTTGACAGAATGGCTTTTTATGGACATGACCATGTAGTCTTGATCATCAGCTCCTGGA
TTTTTTCAGTGTTCCCATGAGAAGTGTCTTCCCATTGATTTCTTCATGGTTTGGGTTTTG
TGGGGTTCTGCAGGGCAGACGGCAGCTGCTGGAGTCCTGTGCTGTTCCGCAGGCCCTGGC
ATCTGCCTCCTGTCCTTCCTGACTCTCCTGTCCTTTTCTGCACCTGCATCCGAAAGTGAG
TGTGGTCTGCTTGTGTCCTGGTCATTGGTAGTGCAGGGAGAGGAAAGCTGAAAGGGTTTT
CCCCGTGTTTGGAGGGTCCGCTCTGTTGCTTCCAAATCCTGGAGCTTTCACACACTCTGG
TTTCTCCTGCCAGCCCTGGAGGATCTGGTGCTTTCTGGGCTGCCAGGAGAGTCAGTGCCA
GGGAATGTCACATCTGGGTCTTTCTCTTGGCCTCCTGTTCCCGGGTGTCTATATGGAGGG
GGTGTTGCCCAGCACAGACTCTGATACTGTGAGGGAAGTCTCAGGATTCTAGAGCACCAG
GCCTGATCATGGGAGGGAGGTTGTGTTGAAGGAGTCAGAGTGAATTGCAGTGAATAGCAC
AGTTAGGGGTCAGCAGAATATTGGCACATACATGATTTTCAGAGAACAGCTGCCTAAAAG
TGGTGTGGGGGGCAGGTCTCTGACGCACTTAAATAGCAGGGGTGATGAGGAGGGCATTTG
CCAGGGAAGTTGGGACACCGTGAGGGAGACCTTGAGGCTGGAGTGAGCAGGGCAGGTGGG
GGTGGCATTGTAAGTTTGGGACAAGATAGGGTAACATCTTTCTGTATCACTTGGCCTGAA
ATAGAGGGCCAAAAATGTTCGTAGGTAGGAGAAGAAAAGGAAAGTGCTCATTGCTACAAA
GGGAGTACAGCTTGGTTTTGAGATAGAAAACTATTCCTTGCTTCCCACCCGAGAGCTTTC
ACTGCTCTCTTGGCCCTGTGAAGTGTGCCTTGATGTCCTCTGCCATTTGTCCTGGCCTTT
GGGGTTCACCTTTGAATGACTTGTTCTCAGGCTGCCCCTGGAGGAATGTGTGAGGCGGTA
AGATCAAGAGTGGAATGACAGAGGGAAGACCACAGAGAAGCCATTGATGCAGTCACCTTC
TAGTCCCTCTCATCCTCCGTTGAGAGCTATTTTTTTATTCTCAAACATCTTGGGTAGTTG
AATATGTTATATGAAGTGACATGTACAGCTTCTTGTATTGCAGGATTATCGGCTGGCCCC
TGTCCCGTGTGTCTGGCTGGACCCCTTGATACTTATAAGGTATGAATCCTGGGTGTTTCT
CTAGAGAGTGCACTGATGTTTAGCTGCAAGGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved