Otolemur_garnettii Locus Mono:89:SNORA36
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:89:SNORA36
Otolemur_garnettii
Mono:89:SNORA36
scaffold_102896
SNORA36
1001..1130
2130
TCCCATTTATTTAAAAATAAAATTACATATTTGCTTATATACGCATAAAAATTTTCTGA
AAATTACATAAGAAACTGTTAACTAGATTACCTTTGGAGAATAGTATTGGGGGTTAGGAT
GTGAAGAGGGAGACCTTTTCATTTATACACTGTTTTGAATTTTTTGTCATGTGTACTTAA
AAAACACAAAATTGAGGAGGGATCCTCCTACTCAAAAATGATGAAGCATTCTTTCAAGTA
CATTTCTCTAGGATTTAAATTTGATATTTTTCAAGCCAAACTGACTTAAAGTACTTGATG
TTTTTTCAAATGTATTTCTAACCATATTAGTAGGGTCACACCTATTGACAGGCTTTTCAA
ACAATCACATTGCTATATTTTTAAAGATGACATTTTTAAGCAGCCATTTTAGCTTATTAA
TTGATAGAAAGCTTTGGCAGTATCTCAAACTGAAGGCAAAGAAGAAGATAGAAGCTTTAC
AATTCAGAAGCCAGGTTCTATCAATTATGAAAGGGAAACTAAATTATTTCTAGAACTACC
TTGTTTATCGAACACTGGGTTAATGAATAGGTGTAGCACTATGCAAGTTAGGATCGCATC
TTCATCTTAAGCTATGTCTACATTGGTGACCCCCCACCAAATAGTTAAAATTGAAAATAG
TCCATCTTTCACTTGGAATTTTATCTACAAATACATAGGTACAAAAGTTTTGAGATACAC
AAAAATCAAGAAAGGTAACATCTGTGCCAATGGAAACAAATGAAGCCCTCCCAGCAACAC
CAATAAGCCGAGCAAGTTGAAACTTCCACAGGTAAATCAGAAAAAACACTGTTGACTGTG
TTTCTTGGAAGTGAAATAATGGACCATAATACAGTTTGTCTTTCATAGTGACCCACGTAA
GCCCCCTCAAAAAAAAAAAGTTGGGACATAGGTCACTGTAGACAACATTAACCAGTGTTA
ACAGGTGAGTAAACTGTGGTAGTATAGGTTTTGTGGAAGCCTTCCTTGTTTGTTTAATTA
AGGAAATCCTTCCTTGTTCTGTTAATTAAACTTTGGGACATTGAAATGGGATAGTGAAAA
TGACTGGGTAGAAGGCATTATTCTATTCATTTTATCTTCTAGCCTTACAAAAATGAACAA
AAAAAAAAAAATTAAGGAAATCCCTGGCTCACAAGATATGAGATTAATTAAGAACAGCAG
AAATCCCTCTGTACCATCAGAGAATCAATAGAGATGATGACATTCTCTGAAATATGTATT
GACCCCTGCATATTTCCACTAGGACTTTCTCAGCTCAAGACAACATGGTTTGCATGCTCT
AAAATCTTCTCTGCCTAAGTTCTGGGTCTATGGCAGGGCTCATGTATGATCCTGTTTTGG
CTTTAGAAGCATTAATTTGCAACTCTTCTATAAATCAATGGTGTGACACAACTGGAAAAA
AAACTCATGACCTCAATATTATAAAAAATGTTTATTTTAGGGGAAAGTGGCAAGAAAGCA
ATGACAATTTTATTTTTTGGCCCCAGAATAGGTTACAATTTTCTATAGATTGCTTAAAGA
TGTGATAGTCGTAGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved