Otolemur_garnettii Locus Mono:358:SNORD20
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:358:SNORD20
Otolemur_garnettii
Mono:358:SNORD20
GeneScaffold_3447
SNORD20
1001..1080
1377
CCTGTCTGGCTGTCCCAGTTTGCTGTTGTGCTGCCCCGGCTGCCCTGCTGCTGTTCTGT
CTGGGTCCTATTGTCCCTCTACCCTGCTTGGGTTCTGCTGGAGGCACCTAAGCATGTGCT
TCACGTCCATTCCTGGTTCCTTCTGGTCTCTGTGATGGGACTATAGAGCAAGTAACAAGG
GGATATTGCCAGCTCAGGGCCAGAGTTCTACAACCTAAGGAAATGGACAAATTTCTTTAA
AGAAAATCATCAAAATGTACATGAGAACAATAGAAAAATTTTAAGAAATTGAATTAGATG
GATATGATGACTGATTACCTGAGAAATAATTGATGAGATTTCAAGAAAAAAAAAAAAGAA
ATTGAATTAGAAATTTAAAACTTTCCTAGAAGAAATCTAGGCCCAGGTGGATTCACTGGT
GAATTATATCAAATATTTAAGAAAGAATCTAACATGAATACCCAGAAACAGCAGGAACAC
CACAGCGCATTTTAATTTTTATTTATTTTTGAGACAGAGTCTCAGTTTTGTTGCCCTCAA
TAGAGCGCTATGACATCATAGCTCACAGCAACCTCAAACTCTTGGGCTCAAGCAATTCTC
TTGCCTCAGCCTCCCAAGTAGCTGAAACCACAGGCACCCGCCACAACACCTGGCTATTTT
TTAGAGTCAGGGGGTCTCACTCTTGCTCAGGCTGGTCTTGAACCTGTGAGCTCAGGCAAT
CCACCCACCTCGGCCTTCCAGAGTTGTGGGGGTTACAGGTGTGAGCCACTGCGCCCAAAC
CTGCAGCTCGTTTTAAAGGCCAGTGTGGCAAAACCAGACCAAGACCTTATAAGAAAAGGA
GATGCAGATCAGTTTCCCTCAAGAACACAAAAGTACTTACCAACATATTAACAAATTGAA
TCCAAGGAAAGGAAGGTGTGTGGTCAGTGCTATCAGATGGGTCCTGGCTAGAGGGAATGT
GGTGTCAAGAGGTTTCTTATGGTGAGAAGAAGACAGCACCTTAAACACAATTGAGAAGCC
TGGGGATAGCAACTTGAGCACCCATTGGCCTCAGAGAGGGTGGGGGCATCAGTAGGGTGT
CTCGCCAGACCTGTGTCCTGGAAGCCCATACACCCTGCTCGGTGGGCACTGAGTCCTGCT
TCCCTGACCGAGGAGAAAGCCGTGGGTCCTGCTCCTAGGCTAGTCTCAGGTTTTGTAAGG
TACATTCGGGATTTAGAAATCATTTTTCTCCACCCAGCCTAATTTGAGACTCCTGAAAAG
AATGTCACACCACTTGGTTTTTAGGGCCCCTCCTGAGCCCTCACCCCCGTGCTCAGTCAT
CAGGCTAGAATGGTGGGTGGATAAAGACATGTTTGGACACAGCCCTTCCTGCGAGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved