Otolemur_garnettii Locus Mono:237:SNORA76
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:237:SNORA76
Otolemur_garnettii
Mono:237:SNORA76
scaffold_81910
SNORA76
1001..1128
2128
AGTGTTTTTACTTAAATGAACTTCTCTTTCAATATCATCTAAAATTAATATGAACTTGA
AAGAACAATATATGTCACAATTTTAGGCTTTCCAATCTTAATGGAAGCCTCACTTAATTA
CATTTAGGTCCATAACATACACGTCTTGTGAATCATGAAGGGAGCACCACCTCCAAGTCA
TGTTTGCAGCAAGCAAGAATCACCAGTAGCTTCTTCAACCACAAAGAAATAGTTTTGCTA
ACGTCTTCTATCAATAGTAGCTTGTACTAACTACAATGTACAAGCAATAACAAAACTTTT
TAGAAATTTATAATCAAATGTTTAATCTGAAAATGTTTACCCAAACATGACTTTCTGTCC
ATGTTTGCTTAGACGAGTACAACTCTGAGACAATGACATGAAGGCTGTTAACCAGTTGAT
GAAAATATTTTAGATTGTATATGAAAACAGCACGCCATACCCCATGACTGTATCAACTAC
ACAGCTATGATTTAATTAAAAAAAAAAAAGAAGAAATGTAGGTATCGATAGAGGGATAAT
AAAGTTTATTTTCTTGTTCTTTCCTGCCACAGTCATCAAATAGTGTTTGGTTTTTTACAT
GCTGAATGAATGGTTACAACTTCTTGACTTGCATTGCAAATATAAACCTTAAAAGGATAT
TTACGGTAAACTGAACATCAAACCAAATTGAATGCTTGGAAAATGAAACCATATGGAAGT
TTGTCCCTCCCTGCAAAGAAAAGCCTACAAAAATTACGATTTATTTTTCTGTTTACTCAT
AAAATATTTCTGCAGCATATAGGCCATAAAGCAGGCAGTTAATATTAAACATTCAAGATT
CAGTTTCCTCACCTATAAAGTATGTATCATAATGGTATATACAATACAGTTACCTGAATT
AAATAAAATAATAAAAGTAGTACTAGCTTCGTATAAATAAAATATTTACTATTATTTCCC
TTATTAATGAAAATGTCATACATGGGTCATTCAGCATTCTAAAGACTTATTTATACTCTT
AAAAATTAGGAAATTGGGGGTCAGGCTGCAGCGCCAGAGCACAAGCTTGCGTATAACTGG
GGCCGCCGGCCTTCTCCGCGGGCGGCCCTTTTAACCGCAAGCGACATGGCGGTGGCTGTC
GTGGCTGTTGCGGATGGGCGGTTTCCCAGACGCTTGGCGATGACTGGTACCGGTTCGCCG
CCAGTTGGGAACTGGGCCGCAGAGCTCCGCCTCCCTCATCCCCCTCTAGTCCTTGGGGAA
GTTGTCTTCCCTGAAACATAGGAACTGGGCCGCGGGCGCAGCAGCATGGGAAGGTGCTTT
GTCTGTATTTACAGTAGCTCCACACACCATCTCTGAGCTCTGCTTCCCGCCACCCCACCC
GGCGTCTAACACAAAAACCGGTTCCAGGTGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved