Otolemur_garnettii Locus Mono:477:SNORD65
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:477:SNORD65
Otolemur_garnettii
Mono:477:SNORD65
GeneScaffold_2348
SNORD65
1001..1071
2071
TTAAACAAACATTAAACCGCAAGTCAGGATAAAATTCCTACCATACAGAAACAAAGCTG
TGGCTGATGAAAGGCTTGCCCATGTTTAGTCAAGCAAGAAAGAAACTAACATGATGAAGT
CATGTCTTTTATGGGAAAGAAATCGTGTAGATTATTTGAAATCAGAAATATTTGTTCAGC
TGGGCAACTTCAAGTAGTGTAAAACAATACGGGAATATTGAAAGTACACACAGTATGCTC
GGAGTTGATGGGCATCAGACTTGCTGAGAAAGGAGAACAGGGACTAATGATGGGTGTGAG
TTCAGAAGAGCTTAGCATTAATCCACCAAAATGAGGCTGGCATCTGGGGGCGCAGCCTGC
TCAATTACAGTCACAAGGAGCATCATTCACCGATGCCTCTGACTTCTTAGAGGCTCAGTG
CTTCAACACTACACTCTACAGTTTTCCTTTTTAAAAAAAAGAGAAATTGAGCATCTCCCA
AAATATAACACTGAATATTATACTATCACAAAGCCTAACTAAAAAAAAAAAAAATAGGCC
AGAACTACTCAAAACCTTAAAACAAGCAACCAAATCAAGACAAAATACCTGTAAGATATT
TTCCAAAACACCTGATCCCTGCTAGTGAAGGGCCAATATAGCTTGCACCAAGATTTCCAT
TTGCCTCCACCAAAAAAATTTAAAAACACAAACAAAAAAATCTCAAAATGTTAAAAAAAA
AAAAAAAAAGTAGGGCAAGTAATTGATTTCTACATCAATAAAATGCAATGCCTGGGACAT
TGCATTTGTCCCACCACCCCCAACAAGAAAGAAGAGAGAGAGAGAGAAAGAGAGAAAAGA
ACAATTAGTTGAATATGGTGGCACATGACCAAAGTCTCAATTACTCAGGAAGCTAAGGCA
AGAGGATCACATGAGCCCACAAGCTCAAGGCTGTGGTGAGCTGTGATGAGGCCACTGTAT
CACAGCTTTGGGCAACAGAGTGAGACCCAATCTCGAAAGACAAATGATGAAATCACCCCA
AATAGCTGGAATTACTGGCAGATTATAGTGGTAAACCTACAGTTTTCTGAAGAAAAACAA
AAAATTGAGGCCGGGTGCGGTGGCTCACGATTGTAATCCCAGCACTTGGGAGGCTGAGGT
GAGTGGACTGCCTAAGGTCACAAGTTCAAGACCAGCCAGAGTGAGACTCCGTCTCTTAAA
AAAAAAAAAAAAAAAAAAGAGCCAGGCATTGTGGCAGGTGCCTATAGTACCAGCTACTTG
GGAAGCTGAGGAAAGTGGATCACTTGAACCCAGGAGTTTGAGGTTGTTATGAGCTAAGAT
GCCATGGCACTTTACCAAGGGAGACCAAGTGGACTCTGTCTAAAAAAAAAGAAGAAAGAA
ATTGAGAGAGAGAAGCAGAGTACAAAGTGCTACCACAGTGCTAAGTAGGGAGGAATATAG
GAGAGATGCCTAATCCAGGTATAGCAGAAATGACATCTAAATTGAAAGACAAAGAATTAT
TAGGAATTAAGACAGACAGAAAAGGGCAAATGGATTCTTGGCAGAGACAGTATGTGTGCA
AAAAAAAGCCCTAAAATTAAGAGACCGATGGGTCTGAAGAAATAAAACACTTCACAATAG
TAGAGCACAGGGCATGACAATTTCAGCAAAAGCACAAATGCCCTGAAGAAAAGTTTATGA
GGCCAGGTGCCATGACTCACACCTATAATCCTAACACCCTGGGAGGCTGAGGTGGGTGGA
TTGCTTGAGTTCAGGAGTTCCAGACCAGCCGGAGCAAGAACAAGAGCCCAAGAGCCCGTC
TCCACTAAAAATAGAAAAACTAGCCAGCATTGTGGCAGGGTCTCTAGTTCCAGGCTACTC
AGGAGGCTGAGGCAAAAGGATCACTTGAGCCCAAGAGTTTGAGGTTTTTGTAAACTATGA
TGACGCCAAGGCACTCTACCCAGGGCAACAGAAAAAAAGTCTAAAACAAACAAAAAAAGG
GGGGGTGGCGACTGGTGCCTGTGGCTCAGTGGGTAGGGCGCCGCCCCATATACCAAAGGT
GGCAGGTTCAGACCTGGCACCAGCCAAACTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved