Otolemur_garnettii Locus Mono:378:SNORA43
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:378:SNORA43
Otolemur_garnettii
Mono:378:SNORA43
GeneScaffold_1980
SNORA43
1001..1138
2138
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCAGCCATCTGACGTACTGCAACTCGGGCTGCCCTGCAGACACTGTACTGGACCTGCCAG
CAACACAGGTGTGGCTGTGCTGCTGTGCCTGTAACATCAGGGCAAAGAGAAAGTGGCTAT
TTCTACGCTCAGTGTTCAGAAACCAGTGAGCACTAAGAATGGTTTATAGCCTGACATTTC
TTAATCACAGTGAGGTAGCATTTAGTTTTGCTTTGGGACATGACCTCACCTGTTCGCTCC
GTGGTGGTGTGTGTAGTGGTTATAGTGTACTTTTAGATGTTTTTGGGAACAGCAGCCACA
TTTGCAATGCCTCTGGGGCAGTTGTTGTTGCCTCTTCCAGGGTTCATGGCAGTGTCTTCA
TAAAATTTGGGAAATGGGAGTTGCTGCTGGCATCTCATGGGCAGAGGCCAAGGACAGTGA
AGTGTCATGCTATGCATAGCTGGCAGCACAGCAAGGAATTATGAGGCCCTGATGCCAACA
GTGTGTCTGTCAAGACCTTATGGGATCAAATCTGAAGGGGGAAAATGTAACAATTCACAG
ATTGGATTTTCTGGAGGTGGTTCAGTGACTCCAGGTTAGAGAAAGAAGCATGGTCTGCTT
CATCACCCTTGTTTATTTTTCAGATCTAGAAGTCGAAAAGGATGTCAAAGTGGAGGTACA
GCTAAGACTCGCCCTTCTGGACACGGGCACCACAAGTGTTGCAATCCGGCAGGCTGTCCC
TGGAGGTCTGCCTGTGTGCTTTCCTTTTATTCCAAGGATGGGCAGGCCAACACTGGTGTG
CCCACTGCCTGTGACCTCAGCCTTTCCTTTCCACTTTGTGGGGTCTGTGTCCCAGCTTTC
CCGCTGGACCACAGCTCCTGGCGCACCTGCCGGGACCACTCCACACATTACCTTGATCAT
CTCTTCTGAAGTCTCACCTCAGTTACTTGAGGCCAGGAGTTTGGGACCAGCCTGAGCAAC
GTAATGAGACCTTGTCTTTCCAGAAAGTTTAATATTAGTTAGATAATAGTAGCTTATGCC
TATAGTCCACCTCCTTGAGAAGCTGAAGCAAGAGGATCACTTGAGCCCTAGGGTTATGGC
GAGCTGTGATGATGCCACTGTACCCTACCCTGGGTAACAACAACAAAAAGGAGGCTCGGC
GCCTATAGCTCAACTGGCTAAGGCGCCAGCCACGTACAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved