Otolemur_garnettii Locus Poly:9:SNORD116
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:9:SNORD116
Otolemur_garnettii
Poly:9:SNORD116
scaffold_82685
SNORD116, SNORD116, SNORD116, SNORD116
1001..1083, 3296..3371, 4197..4279, 6492..6567
7567
GCAGGGAGAGTGAAATGATAACCAGTTAACAGTGGGCAGTAGAGCATAGAGAACATAGT
CAGCCAACTCCTGGGGAAATTGACTTTCCAAAAATAGGGGACTGTCACCACTTGTCCAGT
GATTATTTAACTCTTACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTGCTCACATCCCGTGGGGGCCA
ATTCGCCTGCCCGCCGTCTTGCGGGGGCTCTCAAGTGGACAGGCTTGGAGTGCCCGGCTG
GCTGGGGCCATGTTTCCGGGCGTGGCCAGAGTGCAAGCGCTGGCATTCCCACCTGGATGG
GAGGTGCCACCTGGCCCTGGCCTCAGTGGGCGTCCTTCCCCTTTGCCGGGGATGTGCGGG
GCCAAAGTTGAGGCGGCCGTGGTAGCAACACGTCCTCGCGGGCCAGCCTCCAGAGCGATG
TGAGCAGGCTGCTTGTGGTCTTCCACGTGGCGCGACCAATGCGGAGCCCCAGCTCCGCCA
AGCGCTTGGAAGGAGGTGTCCCATTGGGCCTCTTGTGCTTCCCCTGTACTCTCCAGATGG
GGTGTGCCGTTAACGCGGTGACCAAGGACCCGTGGAGCAAGCAAGTGCTGAATGGGACAC
GTGCAGCAGGCCCCTCCACCGCAGAGGCCCAAGACAAGGGACCCGTGAGGTAACACCCAG
TGGCGAGTGGACTTCCCGGCGCGGGCTGTTGGCAAAACGCCGGCACCCGGTCAGCTGTGA
AGAGACCGAGACCCTGGCGCTGCGGGTCGGGAGCTGAGGCCCGACCGTCCTCCGTGCTGG
GGTCGCGGGGGAGGGAGGGTCCCAGGGCCACGGAGAGCTGAGGGTATCCCTGTCTGCCCC
CCACCGTCCGGGGCTCAGGGTCCCCTTTGGTCGATGTGCCTGGATCGATGATGACACAAC
CAAATGGATGTCCTTGCAATCTGAACAAAATGAGTGACCGGGCCACTTCTGTGAGCTGAG
GTCCAGCACGGGGACCAGGGCACGGCAGCCACGGGCAGGTAGTTCTGTGGGGCAGGTGGC
AGGTAGTGAGCGCCGCGCCTAACTGGTCCCTGGTCCTCCGATGTCTGCCTGCTTGCCTCG
CCCAGCGGAAGGCAACGGTGCCTGTTTCTCGGGCTAGCCACTTGAGGGCCGCGTCCCTGA
CACACAGGAGAAGCAGACCCCGGGAGAGAGGCCCCTGACTAGGGAGAGGCTGGCGCAGGG
GCACCGCCCGCGCTCGTTGGTTCCACTCACACATTTGTCGGGGGGGGGCCAGGACCTGGC
CTGTGAAAAGAGCCCTTGGGAGGGCCAGGGTCCGGTCGACAACGGCGCAGGTGGCCGCTT
TGTCCCGGGTCACTGTCCTTGGCGCCCAACAGTTCCCAGCGGGCTCCTCTGGGGGCGCTG
TGGCAGGGGCTGCCGACTGAGCCGCTCAGGGTGGGCCGGCTCTTCCCACTTTGCTGCCTT
CTCCCTTGGAGCCGAGCCCAAGCAGCCACGTGCCTTTGGGCCCGGGACGGGGCTCCGCGT
GGCGGTTTTCCTACCGCCACGGAGCAGGGCAGCGTTTGGGCCGCAGCAGGGACAAGAAAG
AGATAGAGAAAGGGGGAGATGTGAGTGCAAGTCGAAAAGGCGATTTCATCCGTGCTGGAC
ACGGACAGCCCTCTAGTTTGGCGTCTAGGATGCCAGCGGATGCGGCAGCCAAGCGGGCTC
GGGCGGCGTGTCAATGGCTGGGGACGTCGCCCGTCTCTGCTGGGGCCAGGAGGCGGAGCA
GGCGCGAGATGTGCGTAGTTCAGGTAGCGCGACAGGCCACCGTGGGCCTCGTGGAATCCT
GGAAAGGGTTGGCCGAGGAGGCCCGGCACCTCTGTTACGTGGGCGTGGGGGCTCCAGCTC
CATGCTGCCTCAAGCCCGGTGCCGGCGACCTTGCAGAATCTGCCCTGAGGGAGTGTGGAC
TGCGTGGCCGCCCTGCCAGACGGGCCAAGAGGTTCCAGCGCGTTTCCAGGGATAGGCTAG
CAGGGTGACATGTGATTTTGAGCGGACGTGCTGAGAGCACGTAGAGGAGGCCGATTTAGA
GGAAGTTTCATCCGTGGCGCCCTGAGGCGAGACGTCAGTCTGATTTCTCCCGGGCAAAGA
CGTGGGTCCCGGGTCGATTGGCAGCAGGGCTCGCAAGCAAATACTCCCGAGGGCTTGCGC
CGGCTGCCGGCGTGCCTGAGTTGCCCTGTCCCCGGCAGGTGGGGCACCAGCGCAGGCCAC
GGGATCTCACGGAGGGGCACCCGGGGTGTCCGGCTTTGTCGCGGGCAGTGGCCCAAGTCC
GTGGGCAGGGAGACGACAGTGGCCGCCTGAGGTCAGCACCAAGTCCTGATGGTGAGTCGG
TCTGGGGAGCGGGTGGCGCCATTTCCCTGACTTGATTAGACGACTCAGGCAGGGAGTCCT
CCAAGTGCCAAGAGTCGGGGGGAGAAGGACCAAAGAGGGAGCGTGGGTGGCCGAGGCCCC
CAGGAGCCCGCTGGGGCTTCGGTCCCTCTCACGTTAGGATCGTCCATGTGCCTCAGCTTT
CAGTGGCACCAGCAAACACCCCGGCGGGGTGATCCCATTGGGGGGCAGTTCCCAGAGAGT
CGGCAGAGCGTAGGGGACACGGGCAGCCTTGTCCTGGGCTCGGGATTTTCCCACCGTAGG
GGACCGCCAACACTTGTGGGCCCGTTGACCTTGACCCGTGCCCCCGTGGGGATAGAGGGC
GTCTGTGTGTGCGTGTCTGTGAGAGTGCGTGCGTGTGTGTGTGCGCGCGCGCGCGCCCGC
ATCCTCGCGGGCACCCGTCCCCCTCAGCGGTCCCCTGATCCCCGCTGTACTCCCGGCAGG
GCGTGGACCGAGAAGTGGACTCATTGGGGAAGAGCGGTGGGGTGCCCGGCGTGGGGCCGG
AAAGGCTCTAGGGAGCGGTCGTGCCTGCCACCGCCGTGGTCCAGCGGGAATCCCGTCGTC
GTCCGGTAAGGACGTTGCGGCCGCATCGCTGCCGGGTCTCCTGGGGGACGGGGCGCTGGT
GAGGTGGTGTGGAGGCGGGACGCGGGCCACGCTAGCCAGCCGTGGGGCCGGGCATTGAGC
GCGATGCTGGTGCCTCTGCTGGGACAGAGTGGGTCCGTGAGTCCCGGGGTGACCGAGAGC
CACGGGCTCGGTGCCTGCCACACGTGGAGCTCCAGGTCCCTTCAGTCAATGTGCCTGGAT
CGATGATGGCTAAAAAAAAATGGAAACTTTTGAAATCTGAACAAAATGAGTGAGGACTCT
GAGCTGAGGTCTAGCACGGGGACCACGCCAGTAGACACAACACGTGGAGGGAGCTCCGTC
GGTTCAGCTCGTGGTAGCTGGAAGGCAAGGCCCGTGGTGTCCGGCAAGGCAAGCTGCTCA
CATCCCGTGGGGGCCAATTCGCCTGCCCGCCGTCTTGCGGGGGCTCTCAAGTGGACAGGC
TTGGAGTGCCCGGCTGGCTGGGGCCATGTTTCCGGGCGTGGCCAGAGTGCAAGCGCTGGC
ATTCCCACCTGGATGGGAGGTGCCACCTGGCCCTGGCCTCAGTGGGCGTCCTTCCCCTTT
GCCGGGGATGTGCGGGGCCAAAGTTGAGGCGGCCGTGGTAGCAACACGTCCTCGCGGGCC
AGCCTCCAGAGCGATGTGAGCAGGCTGCTTGTGGTCTTCCACGTGGCGCGACCAATGCGG
AGCCCCAGCTCCGCCAAGCGCTTGGAAGGAGGTGTCCCATTGGGCCTCTTGTGCTTCCCC
TGTACTCTCCAGATGGGGTGTGCCGTTAACGCGGTGACCAAGGACCCGTGGAGCAAGCAA
GTGCTGAATGGGACACGTGCAGCAGGCCCCTCCACCGCAGAGGCCCAAGACAAGGGACCC
GTGAGGTAACACCCAGTGGCGAGTGGACTTCCCGGCGCGGGCTGTTGGCAAAACGCCGGC
ACCCGGTCAGCTGTGAAGAGACCGAGACCCTGGCGCTGCGGGTCGGGAGCTGAGGCCCGA
CCGTCCTCCGTGCTGGGGTCGCGGGGGAGGGAGGGTCCCAGGGCCACGGAGAGCTGAGGG
TATCCCTGTCTGCCCCCCACCGTCCGGGGCTCAGGGTCCCCTTTGGTCGATGTGCCTGGA
TCGATGATGACACAACCAAATGGATGTCCTTGCAATCTGAACAAAATGAGTGACCGGGCC
ACTTCTGTGAGCTGAGGTCCAGCACGGGGACCAGGGCACGGCAGCCACGGGCAGGTAGTT
CTGTGGGGCAGGTGGCAGGTAGTGAGCGCCGCGCCTAACTGGTCCCTGGTCCTCCGATGT
CTGCCTGCTTGCCTCGCCCAGCGGAAGGCAACGGTGCCTGTTTCTCGGGCTAGCCACTTG
AGGGCCGCGTCCCTGACACACAGGAGAAGCAGACCCCGGGAGAGAGGCCCCTGACTAGGG
AGAGGCTGGCGCAGGGGCACCGCCCGCGCTCGTTGGTTCCACTCACACATTTGTCGGGGG
GGGGCCAGGACCTGGCCTGTGAAAAGAGCCCTTGGGAGGGCCAGGGTCCGGTCGACAACG
GCGCAGGTGGCCGCTTTGTCCCGGGTCACTGTCCTTGGCGCCCAACAGTTCCCAGCGGGC
TCCTCTGGGGGCGCTGTGGCAGGGGCTGCCGACTGAGCCGCTCAGGGTGGGCCGGCTCTT
CCCACTTTGCTGCCTTCTCCCTTGGAGCCGAGCCCAAGCAGCCACGTGCCTTTGGGCCCG
GGACGGGGCTCCGCGTGGCGGTTTTCCTACCGCCACGGAGCAGGGCAGCGTTTGGGCCGC
AGCAGGGACAAGAAAGAGATAGAGAAAGGGGGAGATGTGAGTGCAAGTCGAAAAGGCGAT
TTCATCCGTGCTGGACACGGACAGCCCTCTAGTTTGGCGTCTAGGATGCCAGCGGATGCG
GCAGCCAAGCGGGCTCGGGCGGCGTGTCAATGGCTGGGGACGTCGCCCGTCTCTGCTGGG
GCCAGGAGGCGGAGCAGGCGCGAGATGTGCGTAGTTCAGGTAGCGCGACAGGCCACCGTG
GGCCTCGTGGAATCCTGGAAAGGGTTGGCCGAGGAGGCCCGGCACCTCTGTTACGTGGGC
GTGGGGGCTCCAGCTCCATGCTGCCTCAAGCCCGGTGCCGGCGACCTTGCAGAATCTGCC
CTGAGGGAGTGTGGACTGCGTGGCCGCCCTGCCAGACGGGCCAAGAGGTTCCAGCGCGTT
TCCAGGGATAGGCTAGCAGGGTGACATGTGATTTTGAGCGGACGTGCTGAGAGCACGTAG
AGGAGGCCGATTTAGAGGAAGTTTCATCCGTGGCGCCCTGAGGCGAGACGTCAGTCTGAT
TTCTCCCGGGCAAAGACGTGGGTCCCGGGTCGATTGGCAGCAGGGCTCGCAAGCAAATAC
TCCCGAGGGCTTGCGCCGGCTGCCGGCGTGCCTGAGTTGCCCTGTCCCCAGCAGGTGGGG
CGCCAGCGCAGGCCACGGGATCTCACGGAGGGGCACCCGGGGTGTCCGGCTTTGTCGCGG
GCAGTGGCCCAAGTCCGTGGGCAGGGAGACGACAGTGGCCGCCTGAGGTCAGCACCAAGT
CCTGATGGTGAGTCGGTCTGGGGAGCGGGTGGCGCCATTTCCCTGACTTGATTAGACGAC
TCAGGCAGGGAGTCTTCAAGTGTCAAGAGTCGGGGGGAGAAGGACCAAAGAGGGAGCGTG
GGTGGCCGAGGCCCCCAGGAGCCCGCTGGGGCTTCGGTCCCTCTCACGTTAGGATCGTCC
ATGTGCCTCAGCTTTCAGTGGCACCAGCAAACACCCCGGCGGGGTGATCCCATTGTGGGG
CAGTTCCCAGAGAGTCGGCAGAGCGTAGGGGACACGGGCAGCCTTGTCCTGGGCTCGGGA
TTTTCCCACCGTAGGGGACCCGCCAACACTTGTGGGCCCGTTGACCTTGACCCGTGCCCC
CGTGGGGATAGAGGGCGTCTGTGTGTGCGTGTCTGTGAGAGTGCGTGCGTGTGTGTGTGC
GCGCGCGCGCGCCCGCATCCTCACGGGCACCCGTCCCCCTCAGCGGTCCCCTGATCCCCG
CTGTACTCCCGGCAGGGCGTGGACCGAGAAGTGGACTCATTGGGGAAGAGCGGTGGGGTG
CCCGGCGTGGGGCCGGAAAGGCTCTAGGGAGCGGTCGTGCCTGCCACCGCCGTGGTCCAG
CGGGAATCCCGTCGTCGTCCGGTAAGGACGTTGCGGCCGCATCGCCGCCGGGTCTCCTGG
GGGACGGGGCGCTGGTGAGGTGGTGTGGAGGCGGGACGCGGGCCACGCTAGCCAGCCGTG
GGGCCGGGCATTGAGCGCGATGCTGGTGCCTCTGCTGGGACAGAGTGGGTCCGTGAGTCC
CGGGGTGACCGAGAGCCACGGGCTCGGTGCCTGCCACACGTGGAGCTCCAGGTCCCTTCA
GTCAATGTGCCTGGATCGATGATGGCTAAAAAAAAATGGAAACTTTTGAAATCTGAACAA
AATGAGTGAGGACTCTGAGCTGAGGTCTAGCACGGGGACCACGCCAGTAGACACAACACG
TGGAGGGAGCTCCGTCGGTTCAGCTCGTGGTAGCTGGAAGGCAAGGCCCGTGGTGTCCGG
CAAGGCAAGCTGCTCACATCCCGTGGGGGCCAATTCGCCTGCCCGCCGTCTTGCGGGGGC
TCTCAAGTGGACAGGCTTGGAGTGCCCGGCTGGCTGGGGCCATGTTTCCGGGCGTGGCCA
GAGTGCAAGCGCTGGCATTCCCACCTGGATGGGAGGTGCCACCTGGCCCTGGCCTCAGTG
GGCGTCCTTTCCCTTTGCCGGGGATGTGCGGGGCCAAAGTTGAGGCGGCCGTGGTAGCAA
CACGTCCTCGCGGGCCAGCCTCCAGAGCGATGTGAGCAGGCTGCTTGTGGTCTTCCACGT
GGCGCGACCAATGCGGAGCCCCAGCTCCGCCAAGCGCTTGGAAGGAGGTGTCCCATTGGG
CCTCTTGTGCTTCCCCTGTACTCTCCAGATGGGGTGTANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved