Otolemur_garnettii Locus Poly:1:SNORD116
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:1:SNORD116
Otolemur_garnettii
Poly:1:SNORD116
scaffold_104704
SNORD116, SNORD116
1001..1092, 4248..4327
5327
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNATCTTTTGTGTGCTATTGGATTTTTTCGGCATGGTAAGCATGCCTGTTCCTCA
GCAGGCTCATTTGCCTCTTGGCCAGTGGTAAAACTGTGCATGGATCGATGATGACTTCCA
GATATGCATTCCTTGGAAAGCTGAACAAAATGAGTGACAACTCTATACCGTCGTCCTCAT
CGAACTGAGGTCCAGCACATGTTTGCAACGTGATATGGCAGAGACACAAAGAGATTGAGA
GAGAAGGGTGATAGAGAGGGATGGAAAGAGAGAGAGATGGCTTCCATGCATTCAAGTGTC
TTCCTGCATTGTGTTTATCAGGGCTTGGGACACGGTGCTGCCAGAGCTATGGGGAGTTAC
TGGGTAGTTCTCCATTTCAAGTTGAGGACATGGCCCTGAAAGAAGAGCAGAGTCGGTGAG
AGGAGGTAAGCCCTGACCTTCCCGTGTTAAGGGGTTGGTGAGTGTGCATTCAGCACAGGA
AGAGTGAGTCTTGCCTTGCCTTTTTGATCCCAGGGTGGTTCTTGAGGTCATGTTCCTTGC
TGTCATGAGAGACAGTTTGTTCTGGTCAGGAATAGAACACTAGCCTATTCCTCTTCCTGG
GCAGTCACTGGCTCACTTCCTTGTAGGACAGGAGGGATAGTGTTTCTCAGGTTTCTGGGT
AGTACCAGAGGCAGACACAAGCAGACTATGCACACTGGTTTCCTGTTCTTTCAGGTGCTG
TGGGATAGTGTCCATACTTGGTTTATCAGCGCCCATGGATACCCCAATCTAGTGCCCAGA
GATGTATCTTGCGGGTTGGTAAGAGTGAATGCTGTTGGTGTTTCAATTTCCCACCACACT
GTGGAGACTATTGCATAATATTTGTGTGTCTTTCTGGTGTGGGATTAAGTTGTAGTGGGA
TATAGTGAGGCATGCAAAGTTTATGTGGATGGGCAATGGAATGGATGCTGTGTCCACATG
TATCCAGGTGGAAGTAGCATGTGTTTTAGAGTGCCAAAGCACAGGGGCCACTAATCCCAT
TGCTTGCTGAGGGTCAGGTGTTGTTAGGTGGCTAGCAGTCTATCATCCATATATTAGGAT
GCTATTCCATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTGCT
CTGCTTATGCCCATTATGTAGCATGTCCTCCTATTTTCAGGGATAGGAATATAGACCAGG
ACTTTGTGATTGTTATGTTGTTTTCTGTTTTTCCTTGGATGGATTAGGGTCATAGGTTAT
AGGGATTGGATATAGAAAATGGGCAACCCTCTGTAGGTCACACCAGGTATGACCAGAGAG
AGGAGACATGTGGTGTCCTCATGTGGACATACACATTGGGGGTGGGTATAGAAGACTTCC
CAGATATTCCTGAGCCAGTCTCCAGTTGCGGGTGTAATTTTTGGCATGGTAGACATTGCC
AACAAAGTCATCCAAGGGCTATTCCTGTGATTGCTCCTGCTGCAGGGTCCTCAGGCTGGT
GTCTAGCTGACCTAGCCTTTTCCTGGCTGACTACATCTCCTAGGTTGTCTTCCTCATAGG
AGAACAGGTCCCATGGGGTCCCACTTGAGGACATGTAGACCCACTTGAGGACATGTAAAG
ATAGCCAATCTTTATGTGGATCCTTCATCCCTTTCCTGGGAAGCTTCCTTCTTGTAAGTG
TCAGAAAGGAAAGTTCCACATCAGTGCTGGGCGTATTCTCCTGTGATCCCGCTCTGCAGT
CCTATTTGCCTTGAGGAAGGATAGGTGTGCGCTGCCCCAGGTGCACCACAGTGGAGTAGC
CATTGGCTTGGGAGACGGTTGATTCTGGGTGTTGGTGGTGTTGTCAGTGTTCCATTCCCT
GTGTAGGTGGTCAGAAGCCTATTTATTCCCTTAGGGAGTGGACAGGGATAGCATGACAGG
GATGAGTTGAAAGGTTACCTGGCTGGCAGTTGAAGGAGAAAAGGTGGGTGTGATTTGTTA
TTGTTTGTGCTCCTTGTAGGCGCTTGGATGACTGGGAATTGATGGGTCCACTGTAAGTAT
TATGGTTTTGTCGGGGTCCTGCATTGGAGGCATGAGGATCGGGATTTGGTCAAGGTAGCT
GTGTGATGGGCCCATTGTTGCAGTGATTACTCCGGTGAAGCTCCCTGGGGGTGATACATT
CAAGGCCCATGGACGACCATGTGCATGCCTCTTGGCAGAGGGGTCTTCTCAGTTGTCTAA
CAGGCAAAACACCCATGGTTCTCAGGTGTCCTTGTCACCCCAGGAAATGCTTGTTGGAGC
CCCCAACAGAGGGCTTCGATGTTGGAAGTCAGAGTCAGGCTGGCTGTATGAGTCCGCCTA
TGCCCATTAGGCAGTGAATCTGATCGGCATCCCTGTTCAGAACGTGACAATGTCCAGTGA
TATTAGTGGACTTTGGTTTTGTACCAGGTGTGCCTCCATGGCTAAGGTTCCCGAGCCAGC
ACCTCCTCATTGTTGTCAGATTCCAAACATCAGGGGAATCGTGAGGGGCTGTAGTTGTGC
TTGCAGAGAATTTATGATTTCAGGAGCAGCCTTGGTTGGTGGAGGAGTCACGCATGCCTT
TAATCCTCAACAGGCTGTGCTCAGAGTTGATGTCATTTATGTGGTAGGCCTTGGAGTCAG
AGTCCGCCTTTCCCGGTGTCAGGTATAGAAGGTGGGCAGCATGACTGCTCCTTCTGGAGA
TGGGGAACACACAAGCACCCTAGGGTGCCAGGCGCATAGGGACCTACACATGCAGTCCAG
CACAGAGAAGCACACATAAACAAGAGTACTCCTCAACTTGGAGACATGATGCATTCGGTG
AATGTCCATATTGTTACTTTTAGGGGAATTCATGGAGATGAAAAGGCAGATACTGCAAAA
CAGGATGTCAATGAGAAGGCAGGGAAGTTACTCTGCTGGCAGGTATCGCAGTGCAGCAGA
CACATGTGCCCTTGAGTCCCTTTCTGAAGCATGCATTCCGTCTGTGTCCACTTCTCAGGG
GCAGTTTCCTTGAGAGGCATTCCATAAATGGGTGAGAACGCATGCATTCTTTCTGAGGAC
AGATTTGCCTGGAATCGTGGAATTGCTATGGCTGAGGCTGCCAGATCACTCCGGAGTGTA
AGCATTTCCTTGGTTGGAGGGCTGACGCTCTGTTTCAGATTTTGTAGCTTCTCCCGGGAA
TGGCTTCTCAGTGGCAAGGTTCTGGGTTCTCCAGGGTGCAGAAGACCTTGGTGGTGACTG
GCTCTCCTACTTCCAACTCTCTATGCTCCAGTGGCTTGGAATGTGCTTGGATTGATGATG
AGTTTCTTAGAAAAGCAGAACAAAATGAGTGAAACACACTATCAACTTGCTCATCAGAAC
TGAGGTCGAGTACCTTGCCTGAAGCAGAGCCTTTAGTAGTGACTGAAAACATGCACTGCT
TCAGATTCCTGCCATCCCTTCAGGGCACACACAATGGGAGTTCTCCCTGGGTAGGTGCAT
CAGGAGTAGGGTAGCATGCAAGGCATCTAGATGGGAGATTTGTGAGTACAATGGTGGCTA
AAAGTGATGAGTTGGTGCCATCATTTCTAGCACAGGTATTGCTGGTGAAGGTCGAGGTTC
AGGCTTCCTGGGCTTAGTAGGCCGACAGGCAGGATCTGTGTGTGCAGGCAGAGGCCTGGG
CCTCCAATAGCTTGAGACAAGCAGATGGGCTAGGTCTTCAAGGTACTGTGAACTTGGACT
TCAGCTTTGCCGGAGTAAAGCTAGGTTTAGTGCTGTTGAAGGAGAAGGGTATTGAAAAGG
GCAAACCCACTGTAGTTACACCCACCCCTATTTTGCCTTTAAGTTAAGGGCCCAGCAAAG
CAGGAGGGGCTGTCTCACCACCCTCTTTATCACAGTGCCACAGTTGGAGTCAACGTGAAC
TGGGTCTTGATCATCCTGGTGGAAGGTATCCCAGAAAGAGGTGACACGTGGTATCCTCAC
TTGTACATCCACATCAGAGTGGGTGGAGGAGGCTTCTCATAGATTTCTGGGCAGGTCTCT
GGTTGTGAGGAGAATTTTCGGTCATGGTGGAGATTGCCAGCCAAGTCATCCAAGGGTGGT
CCCTGACACCAATTGTCTTGAAGGGTCCTCAGGCTGGTCTCCCGGTGACAGCCTTTCCTG
GCCAACTAGGTCTCAGTGGTTGGGTTCCTTGTAGGGGAACACATCCCTTAAGATCTGACT
TGAGCACGTGTAGCGTTGCGGCTTTCCTTAGCCAATATTCCCATGGATACTTCATCCCTC
TCCCAGGAAGCTTGTTTCTTGAAAGTGTCAGGAAGGAAATTTCCATGTCAGCAGGCATGT
TCTCCTGGCATCTGGTTCCACAGGCCTGTTTGCCTTGAGGAAGGGCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved