Otolemur_garnettii Locus Mono:32:SNORA19
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:32:SNORA19
Otolemur_garnettii
Mono:32:SNORA19
scaffold_91590
SNORA19
1001..1129
2129
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCTTTCTAAGAGTAGAATGTGAACGTTTTAAAACAATAACT
GAGTATTTATGACATGAAGGCTGTGTTGACCAGTTTGATGGAAGTATTTTGGATTGCATG
TGAAAACCCTACACTGTACCCCAGAAGTGCATTAATGTACATAGTTACCATTCAATAACA
AAAAAAAAAAAAGACTGTAATAACTGAGCCCTCAGCCCCTATAACTGAGCCCCCAGGCCC
TAACCCCCAGGACGAGTAAGAAGTGCAACAGTGCTCGCTTCAGCAGCACATATACTAAAA
TTGGAACGATACAGAGATTAGCACGGCCCCTGCACAAGGATGACACGCAAGTTCGTGAAG
CCTTCCATATTTAAAAAAAAAAAAAGAAATGCAACAAAGCCCATATATTTGTAAAAAGAA
CTTCTCCTAAGCCTTTTAGCCTCAGCCCCCACCCAAGGGAAGAGAAATTAAGATCTGGGA
AGAAGCTCCAGAAGATAAGGGAAGGAAGGGAGGCAGGTGTGAGCCCTGGGTGAAAAGGGC
TGAAGTTGGTTTAAGGCCCAAGCTGTTCTCGGGAATTTACCAAATACCCCTCATTTGATG
ATTTGTAAGTTAATGTATCTAAAGTTAACATGTACCCCCACCCTGAACTGTGTAACCCCT
TATGATGCACCCTATCTTATGATGATGAAGTAATGTGTATCTTGTGATGTGTGAATCAGT
ATGTACCGTCACCTTGCAACCCCGCTCTAACTGCTATTATTAGCTTCTGTATTGCTCTAG
CTTGCTGACCCTTGCAAAAAAATAGTATAAAAAGACACTTTGTGCACATTTCATTGACCT
GTTTTCTTTATATGTGAGCAGTGTTATTTCTCATGTGCTATACAGATAGTTGAAGGTTAA
TTAGCAGTATAACTATAAATAGTAATGCTGCCAGTCTCCTTCAGACAAGAAGCTTTATAG
AAAGTGGTTAAATGTATTGGGTAAATAACAGGTCTTTATCTACAAAAGATGTGACCATTT
AGGTTTTTTGTTTTGGGAAACTAAGATTTTAAAAGGTATGTTTGAGGGATGGTATAATCC
ATGTATTATGGTTTAGAGAAGTCTTTGGAGTTGATAGCCTGGAATTCTAATTCCAGCTTC
TGCAATGCTCTGATTCTCTGAGCTTCAGTTGTTTTCTTGAATAAATGGGCATGAATTCTG
CTTGCCATGACTGTCATGACATTGCATATAAAAAGTGCTAAGTAAATAGTGGCTGTTAAA
AAAAAATGAAAAAAAAAAAAAAAGACACTTTACCTGCCAGTTGGTGCTGAACGCCCTTGT
GGTGATCCAGCCTGCCTGCAGGCTTTAATAAATTTTATCAATTATTGCATCAAAGTGAGG
TCCACCTTTTTATCTCCGCGGCTCTGACCCACAAAAGTTACGGCTCTGGCCACATACAGT
GGGGCTGGTGGGTTTGAAGCTGGCCCAGGATACCTAAACAACAAAGATAAAGGCAACAAA
AAAAAAGCTGGGGCTTGGCACCTGTGGGGCAAGTGGCTAGGGTGCAAGCCACATACACTG
CAGCTGGAGGGTTTGAATCCAGGCAGGCCTGCCAAACAATGACAGCTGTAGCCAAAAAAT
GGCTGGGCATTGTGCTGGGCATCTGTAGTCCTAGGTATTGGGAGACTGAGGCAAGAGAAT
TACTTAAGCTCAAGACTTTGAGGTTGCTGTTAGCAGTGACAGCATAGCACTCTACTCAGG
CAACATACTGAGATGTCTCTAATTGTAGCATTCTACCAAGGATGACATAGTCAGACTCTG
TCTCTAATAGATGTATGAGATGCATGCGTAGAAGCGTTTGATTGGGGCTTGCGCACGCAG
ACACAGAGACGAGGATGAGAGCGACTTGACCGGTTTTTTTACCAGATTTTTTTTGANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved