Otolemur_garnettii Locus Poly:4:SNORA76
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:4:SNORA76
Otolemur_garnettii
Poly:4:SNORA76
scaffold_116156
SNORA76, SNORD113, SNORD113, SNORD113
1001..1133, 1871..1942, 6385..6461, 7332..7406
8036
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGTGTTT
TGATCATAGATATCACTTCAGTGTTACTGATAATAGTACTATAGCGATGATGCAATAAAA
AGGACTGTTCTAGACCAATGATAATGACCACTGGCATGTGAGTCATTATAGGTGAATAAT
AGGTGTCTGAGACTTTGAGGTCAAACACAATAAGGAATTTAGTCTACTTGCTGGATTGGA
AATGACTCTGCAGGTTCATATGTTAGAAATGTACAAAGATCTTGTCCTTTACTTTTGGAT
TTGTGAATTTGATAGTATTATTATAAATAGATTAATGATGAAAGCATTAAGTAAATGTAT
AAATCAATCTGTATGATTTATTATACAATTTTGATGATGCTGCATTGTTCAATTATCAAT
ACATATGGTTGAGCAAGAGATATTATTAATGTAAAGTGAGTGCGCTGCCTTTGATTCCTC
GCCGCACCTTCGCGTGGCGTCGGGGGTCGGGCTGTAGCGCCAGAGCATGTGCTCGGGCAT
AACTGGGGCCGCCTAAACCCCTAAGGGCGGCCCTTTTAACCACGAGCAACATGATGGCAT
CCCCTCACCTGTAATATATATGTATATATATTGAAAACAATGATTTCCATTAAGAAATAA
GTGGATCAAGGTGTTACCTCATTTAATGGTCTTAGACACACTGATAAGTCATGGTCAACT
TTATTACTCTGGGTCAGTCCAAGTGGAGGTCGTGTTTTGTCCAGAAAATGTATATGCTAT
ACAAATTAGTAAATACCTAAATGACTATAAAGTCTTTTAATTTATAATTAAATGTAGAAG
GAAGATTCAATGGGACTATGGCCCTGATTTTTTTTTTTTTTTTTTTTTTTTTGTATAAAC
TGCTCTGTTTTGTACTCCTCAGAATGGACAAACTGAAGCTGGTTTGAGGATTCTTCTACA
GTCATAAGATGGTGGTCGCTGCTGTGTGTTTGGTGTATAGAAGCCAAGGTGAGTTTTTGT
GGAAGTACACTCCTTGTTTGAAGAGTATGAAATACATATAATCAAAGAAAGCCAATCATG
ACTTATTGATCAATATGGAATTGATATGTAATAATATTGCCTAATCTATATACAAAAACC
TTAAGGGTGATTACTGAAGGGATATGTTGATGTACCAAATTATTCTATAATACAGGTGAG
GACTATTTAGGATCATCATATTGCTAGATATTTGAACTCACAAGTGGTGGATTTATATAG
GAAATTAGCTAATGATTAATAAGCAAAGATTGATAAAAAGAAAAAAACAAAACAAAACAA
GACCCCAAGCTTGGATCAATGATGACTTCTGATGTTTTGAGTCATAGGTAATGAATACAC
ATGTGTGGAACTCTGAGATCCAAAATATAAATCAATCAATCAAAGATCATTAAGTGTAAA
TGATCTTATACATAGTTTTTCAAGGATCATTTTGGGGTCTTTATTTGCATGGATTTTGAT
TCTTTTATAAGAAATGGATCAATAAAAGAATCTATATGCAAAGAAAAGATCATGTTGTAC
CCCTCAAATGTACAAATTTTATTATTAAAAACTATTTTAAAATAAAAAAATAATGTATAA
GCATAATAAGTAAAGATGAGACTGGTGAAGCATCTAATTATGAAGAAATGAGTAAAAAAG
AAAAAATATAATATATATTGAATATACTAAATCAGTTAAGAAATGAATGGTTCAAAGGTG
TTATTTCTTAATAATAGTAATATAGATAATATCAATAATGGCCAATATTCTTATTCTAGA
TTAATGGAAATTTGTTGTTGTTTCTTGTTAAGAGCGGGTGAAATATACATTAAGCCAAAT
TCTAGATACCTAAATGATTGAATAATGAATTATAGATGCAAAGATTAATAGAGAAAATAT
CTAAATCATCTTACCATTTGCTCTGGTTTCCACTCTTTAGAATGGACACACCCAAGCTAA
TTTAAGGCTTTTTCAGTGGTCTCTCTGGTTGGCTCTGTGTGTAGTAGCGTGGACACCAGT
ATGAGTAATAGTGTTCTCATCTTAAGAGTATTCACTGCAATATTAAAAGAAAGATTAAGT
ATAAGAAGAAAAGATCAACCATAGTCCAATAGAGATATAGAATTGACATGAAACCTTATG
TTGATTAGTCATTTTCCAACAATCAGGGTGATTAATGAAGAAAGTATACTCAATGAGGCA
AATGATTATGTACCCAGTAGACATTTCTGTAGGCATTTGAATCATTACATTTATCAACTT
GCATTAAATATTGAGTATGATTTATGAAAGAGAGATACCATTGTGGAAAAAAGTCGACAG
ATAAATGTGGGCATTTATGGCTCTTATTTTGGTTATTTTTTTTAATCATATGGATTTAAA
AAATAGTGTACTAGTGAATTACTCAATGAACAATTGTAAATAAGAATGAAGAGGCTCGGC
GCCTGTTGCTCAAGTGGCTAAGGCACCAGCCACGTATACCCAAGGTGGCAGGTTCAAATC
CAGCCCGGCCCGCCAAACAACAATGATGGCTGTAACCAAAAAATAGCCAGGTGCCTATGG
TCCCAGCTGCTCGGAAGGCTGAGGCAGGAGACTCGCTTGAGCCCAGGAGTTGGAGGTTGC
TGTGAGCTGTGATGTCATAGCACTCTACCTAGGGGGACAGCTGGAGGCTCCTGTCTCAAA
AAAAAAAAAAGAGAAAGAAGACGTGAAACCTTGACTACGGATGACAACAGGTGATGACAA
CAGGTGATGACAACAGGTGATGACAACAGGTGACGTGCATCATAGTTGGTGAATAATATA
TGTATTAAATTATAATGAGACTCAGGCAAATATTTACATGATCTCAGTTATATGTGGATT
ATAAAAAGGCTGAAATTACAGAAGTAGAAGGTAGAAGAGAAGTTATGAGGAGGTGTGGGA
AATGGGGAGATGTTCAAAGGGTACAAAGTTTTAGTTAGATAGTAGGAATCAGTATTAGAT
CTTTTGAATAGCATTGATACTACAGTTAATGTATTGAATATTCCAAAATTGCTAAAATAG
TAGAGTTTTAAAGGTTCTCAGCACAAAAATAAAAATAAGGATTCAAAGTGATGTATATGC
TCAGTTGCTTGATTTAATCATTCCATAATGTAAATATATATTAAAACATCACATTGTAAC
TCATGCATATATAATTTTTGGGAATTAAAAATAAAAATTTAAAGAATAATTTATTGTGGT
CCCATGGACAGATTTTGTGAACATAAAAAAATCATTTTCATGATTTGTGTTTATGAATTT
TTATTTTAATATAATTTGTGGATTAATGAAAAAATTAAGGTGCAAATACAAATAAGAAAG
AAGAAGATAGTGAAGTATGTTCACTCAACATATGTGGGAGGCATACAAATTATTAATATT
TATGAAACTCCTGAAGTTCTTTATGAAGTATAAATGGTCTAAGTGTCTTATCTCTTTGAC
TAAAACTATTGTAGATGGTATAGTCAAAGTTCTTATTCTTGGTCAGTTGCAAGTTTGGTA
TTTTTCATTTTCTTAGGGAAAAATTAACAATTCGAAATAATATATTTCTAATTGCTTACT
AAATGAAAAGTTGAATGCAGCGACCAACCTTGTTATTATCTGCTTTGCATTATACTTGTC
ATAGTGGATAGACCTAAGCTAATTGAAGCATTCTATAGTAATAGCACACTTCATGATTGT
TTCTGTGTATTAGAACATGGAATAAGCAGTATGAATAATAGTCAATACTCTTGTTGTAGT
TTTAGTGCTTTCTTTAGTATATTCATTGTGATATTGAAAATGTTACATATAATCAAAGAA
GTCAAATCATTGCCTAATTGTAGAGTGGACATGAAACATGTTGCTCAATTGATTTTGCAA
CAAAACAAAAGCAGCATCTAACTAATTGTATGTATCCTTATATTAATCCAAAGAAAAAAG
AAAAATGATATAGTCATTGAGGCAAATGATTTATAGGAAAATATTAAGAATATTTAAGAA
TCTTTTTTGAGATTTTCTGATTTTTAGATATTTATTTTTACTAGAGAATTTTGAATTAAT
CACTTAACAAAAATAGATGAAAATAAATAAAATAGACCCAACACAGGGCAAATAATGACA
AATAGTGTTACATAAATCATACATCCTGAATACTATATATCTTTAGCTCTGAAATCTAGA
ACAAAAAATAATCTATTGCTTCCATTTAAAATTATTTTTAATGGCTTGGTGCCCGTGGCT
CAAGCTGCTGGGGCGCCAGCCAAATACACCTTAGGTGGCGGGTTCGAATCCGACCTGGGC
CCGCCAAACAACAATGACGGCTGCAACCAAAAAATAGCCGGGCATTGTGGCGGGCGCCTG
TGGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGACTCGCTTGAGCCCAAGAGTTGGAGGT
TGCTGTGAACTGTGATGCCACTGCACTCTACCCAGGGGGACAGCTTGAGGCTCTGTTTCC
AAAAAAAATAAATAAATAAAATAAAATTATTTTTAATACATATCCTATAAATATTTAATA
CATACATATTTAATACATATCCTATAAATATTTTTAATACATATCCTATTGCTAATAGGA
TACATATCCTATAAATATTTAAAACATACATATTTAATACATATCCTATAAATATATTAG
ATATATACATATTTAATACATATCCTATAAATATTTTAATACNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGCCCGCCACAATGGCCCGGGCTATTTTTGGTTGCAGCC
GTCATTGTTGTTTGGCGGGGCCCAGGGTCGGATTCGAACCCGCCACCTTTAGGTTGTATT
TGGCTGGCGCCCCCAGCCCACCTAAGCCACAGCGCCGAGCTTATTTTCTCAAATTTTGTA
TAACATTAGATTCTATTATAATGTAGTAATCATTGTAGAAATATAAGCAAGTAAAATTAA
GGAGTGTGAAACATGCCTATTCTTAACATATACGACGAGGCAATGCAACTTATTAAAATG
TATCACAAATACTGACTTGCTTTAATAAAATGGATCAAGTATCTAGCTTTGACTAAGAGT
GATAAAGACAACCTAGTCAAAATTCATATTTTGCATTAATGGCAATTTTAGTATTTTTCA
TTTTCTTAAAGGAAATATCAAGTATTTCTCTAAGTTAAATAAATATATACTTAGCTGATT
GACTAAATGAATGGTGGAATGCACAGAACAAACTTAATAACATCTTAACCTTACTCTCCA
CTCTGCTTTTTACTTTTTAGAATGGACACACATGAACTTGTGTGCTTTGTTCATGATCTT
CATGATTACGTCCTTGTTAGGTGCATTAAGTCTGTGGTGAGTAGTAGTCAAAGTTCTTGA
CTTGATTTAGGTGGTTTATTTAGGGTATTTAGTGTAATATTTAAAAAGTATATTTACTAT
ATTGATAAAAGGTTAACCATGGCTTACTGATAAATATATAATTGACATGCAACATTATGT
TGATTTATCAATATTTGCAGCAATGAGTGTGATTGAAGAAAGAAGTACATTCAATGTAGG
AAATGCTTCTATATATAGATGTTAGGGATACTTAAAGATCTTGTCCGTGAGTTTTTGATT
CTCATATATTTTGTTATTTTTAGTGAACTAATACATTGATCAATATATGATTATGAAAAA
AAGTAGTCTCAAGCCTGAACCAGTATTATTAATAAATTAATCAACGAACAATGAGGAAAT
GAATGAAGAGAAAGGGGGCCTTTCCTGGACCACCGATGATGAGAAGTCCCGGCGTATGAG
TCTTGGACGATGAATAATACGTTCTGGATCTCTGAGGTCCAAAATGAAAGGAATCTAGCC
CACCCCCTGTGGATGGTCTTATACAAAGATGTCAGGAGAATATAATGACCTGTTCTTGTC
TTTGTTTTCATGAATTTTAAGAAATATTTAAATTAAGGTAGCAATGGAAGAACCCATAAA
TATTTCTGTAAATGAATAAAAATGAGAGAGGAAGTACGATATAATTTTAAAATGTATAGT
AAGCAAAAATAATGGTAGCATAAGTTGACATTGATTATAAGTAGGTTAGTGTATTCTATC
TTTGACTAAAGGTGATGTTGACAGGACAATGATGAGTAAGAGTTATTGCTCTGAATCAGT
TGGAAATTTTAAGAGAGAATTAATAAATACCACCATTAATTATAATAATAAATACCTAAG
TGACTATGTAAATGAGTGAGGAAGGTATGGGTCCATAGAGAGAATGTCTTAGTATATTTA
TCATCTTCTCTGCTTTACACTCTTCAGAATGGATACTCTGAGCAATTTAAACATTCTGCT
TTGATCAAGATTAAGTTTCCTCTTGTAGAAATGAAACCAATGTGAGTATGACAGTTAAAA
TTCTTGTTTTGCTTTAGGCTATTTGATGGAGGATATTTATGGTATTATTAAAACATATTA
AATGTAATATAAAGCTAACTATGACCCAGTTACGGACATGATATGAAATATGTGCTGACT
AATTGCTAATTTGCAACATTGAGGTCAATTAATGACAGGCTATGTTATTATATGTAACAT
CAACTAATGTTAAGTATTTTCAAGTATCTTATTCTTGGATTTGTTAATAATATGTTTATT
TAGATATTATTTATAAATTAATAATGTATTCAAACAACTATAGAAACTAATGAATAGAAA
GAGACCCAAACATGGACCTATGGTGACCACTGGTGGCATTTGAGGCGTGTACGATGAATA
ATATGTGTCTGAAACTCTGAGGTCCAACACAGAACATATTAGTCAATTCCTTCCTTTTAA
AGTAAGATAAACATCAGAAATGTCTGAAGATCATATTTGGGATTCATAGATGTATATTTA
TCATTAATAGATCATTGATAGGACAATGAAATAAGTACACATAAAGAAGAGAGTGAATCA
TTGTTCAAGTGTGAATACATGTGATGATCCAAGAAATTTTGCTAAAAGTTTTAAATGCTG
ATGCCCCTTGAGAAAAATGTTTTGTGGGTATCAGTTACCTCTTTGGCTATGATTTATGTA
GACTTTTTAATAAGTTAGAGTAAATTTCATTATAGTCTGAAGTTTGAGGTTATACCCACC
CAGGCTGGCAGGTTTGAACCCGGCCCAGGCCAGCTAAAAAACCAACAATGACAACTGTAC
CACCACCACCACCAACAACAAAAATAGCCTGGTGTTGTTGGAGGGCATCTGTGGTCCCAG
CTACTTGGGAGGCTGAGTTAAGAGAATTGCTAAGCCCAAGAGTTTGAGGTTGCTGTGAGC
TGTGACACCCCTGCACTCTACCGAGGGCGGCCTAGTGAGACTCTGTCTCAAAAAGAAAGA
AAAAAAAAAACCACCTGCCTTATAAAAAGTTAATAAGTGACTGAAGAAGAAAGATAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved