Otolemur_garnettii Locus Mono:226:SNORA30
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:226:SNORA30
Otolemur_garnettii
Mono:226:SNORA30
scaffold_80548
SNORA30
1001..1131
2131
TTATTTTGAGTTAGAAATTTTCTAATATATCAACTAATTCTTGTGTTGTTTCCTTAACT
ATATTTTAAAAAAAAAATTAGTGGCTTCCCTAGGGATTACAATTACCATTTTAACTCAAA
ACAATATGATTCATATTAAAATTAGCTTAATTTTATGAATATATAAAAACTTTGCTCCAA
TATAGCTTTGTTTCTCTCTCCTTTTTATTATTATAGTGATACAAATTTTCATCTTTATAT
ATTATAAGCCCATCAACATGGTTTTATAATTATTGCTTTATGTAATTGTCTTTTAAATTA
GGTCGAATAAAATACATTTATATTGTCATATTTGTACTATTATTTCTTTATTTCTTCATG
TAGATTCAAATTATTGTCTAGTGTTTTTCTTTCATCCTGAAGGACTCCCTTTAGTACTTC
TTATAGGGCCTGTCTGCTAATGATGAATTCTTTCTTTTTTTTTTTTGTTTTGAAATGTCT
TAATTTATTTATGTTTTGAAAGACAGTTTTGTCAGGTGTAGAATTCTCGGTTGATAGTCT
TTTTCTCTTAGCATGTTGAATGTATTATCATACTACTTTCTGGCTCTTATGTTTTCTGAT
GAGAACTTAGCTGTTAGTCTTATCTGGGATCTCTTGAATGTGACAAGTTGCTTTTCTCTT
GCTGCTGTCATGATTCTTTGCCTTGTCTTTCAACAGTTTGATTATGATGTGTCTGGGGTG
AATCTCTGAGTTGTGCTATTTTCACTGAGCTTCTTAGAAATACAGATTAATTTCTTTCAT
CAAATCTGAAAAGGCTTTGGCCATTATTTTTTCAAAAATTCTTTCTATTCTCTCTCATTA
TGTGTACATTAGTATGTTTGATAATGTCTCATAGGCTCTATTGATTTTTCTTCATTTTTT
TTCTTTCTGTTCCTCAAACTAGATGATCTCAATTAGCATTTTTTTCAAGTTTGCTTGTTC
TTCCAGCAGTCCAAATCTTCTATTGAGCCCCTCAAATGAGTTTTTCATTTCAACTTTTGT
AATTTTCAATTCAAGAATTTCCATTTGTGGTAGATGATGCTGAGAGAAGACCCTTGATGG
CATCTTTGCCCTGAGACTCTACCAGTGGCAACTGTCACCCATTGGGACAGAGAAGATTCT
GTGACTTCTTACTTAACTTTGTGCCTTTCTTTTATTATTCTAACAAAAAATAATAATAAA
AAAGAATTTCCATTTGATTATTTAAGAAATTTTTCCCTTTATAGATGTTCTATTTAGGAA
GACATTACTCTCATAAATTCCTTTAATTCTTAGATGGAGTGTCCTTTAGTTTTTTGAATA
TACTTATTTATTATAGCTCATTTAAGAACTTTTATTGTACTGCTAAGTCAAATATTTGGG
CTTCTTCAAGGATAGTTCATATTTACTGCTTATTTTTCTTATATGTGGCTGTACTTCCCT
GTTTTTTTGCAAGTCTTGTATTTTTTTGTTGAAAAGTGAGCAGTTTAAATAATATCATGT
GGCAGTTCTTTGTGGGAAAAATCTGTGGAAATCTGATTCCTCCCACTCGCCAGGGTTTGT
TTTTTCTCTTTGTTATTTTTGCTGTTTGTTTAGTGATCTACCTGAACTAAGCCTGTAAAA
CCTACGTTCTTTGTTATGTACTGTCATTGAAATCTCTGCTTGATTAACTTAGTGGTCAGC
CAAAGATTGGACAGAAAGTTCTTTAAATGCCTTGAACCAATACATCTCCCAGTCTTTGTC
AGGTGGCTTTGTGTGTGTTGAGGTATACTATCAATGGCACTGACAGGCAGTTTACAATCC
TCCCTTAGTTCTTTACCTACTTCTTAAGGAAGAGCCTGAAGTTCAGCAAGGAGGAAGGAA
TTAGGGCCTTCTCCAGTTGTTTCTAGGAATGCATGTAGCCCTGCTCATGTGTGTGGGCTT
CTCAATTCACAGGATTATATTGGATATTTTTAATGTACTTTTATAAATACCTCATTCCCA
AGTTGTTCCTTTTAAGTTCTATGGTCATCCTTTTGTTAGTCCCAATGATAACTTTAGATA
GCTGAAATATTAAACAATTCTTTCTAATTGTTTTTGACAAATGTCTAATCTCTTGAAAGG
GCACCGTGTTGTGTGCCTAGAGTTCCAGCTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved