Otolemur_garnettii Locus Mono:393:SNORA51
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:393:SNORA51
Otolemur_garnettii
Mono:393:SNORA51
GeneScaffold_84
SNORA51
1001..1133
2133
CTCTCCCAGTGTCATTAGCCTCAGGGACCCCAGCTACCCCCAGGAAGGCCAAATGTCCC
AGCCTGACCACACTGATATAGTCACCTTGTCCTCCCTGTAGTCCTAGCACAAAAGGCAGC
TAGCTTCTGCTCTGGTAGGTGACCCCAGCTGGTTTTTAGTGCATAGGAGGGTGGAGCTAG
GGGTGGGACTTCTGGGGAAGGGGGAGGGCCTTCTGGGGACAGGGTCTATCCTGGCACTAT
CTGAGCTGGGTGGGTAATAGCATCTATAAGTCTAACTTACCTCCTCCTCATACCCTGCCT
TGAGGACAAAGTCTCTTCCAGCTCAGCCTTGCTCCCTAACAAAGTACCATGACATGAGGA
GATGACGAACTGAGCCAGCAAGAGAGAAAGAAAGAGAGAGACAGAGGTCTGAGCTGTCTG
GGAGAAGAGATGAGGGCCTGTCCTGGCACTGTCTGAGCTGGGGAAGGAATCTCTGAGCCT
AGGAGAGGGCTACTTCCCCAGCCTTGCCAGCCAGGGAACAGTGCAGACTTGGGAAAGCAG
GTCGGGGAAACTTCTAGAGCTCAGGAGAGTAAAGTCAGCTGGGTGGGTCAAAGAGCAGGG
GTTGTGACTTCCTGGAGCTTACCACAGGCTGTGTTCTTACACTGACTGTATAGCAAGAGG
AGGCAGGCTCAGCACCCATAGCACAATGGTTGTCGCACTGGCCATATACACCAAGGGTGG
CGGGTTTGAACCCGGCCCAGACCAGCTAAACAACAATGACAACTGCAACAAAAAAATAGC
CAGACCTGGGCGGTGCCTGTGGCTCAAGAAGTAGAGCGCTGGCTCCATATACTGGAGGTG
GCGGGTTCAAACCCAGCCGCGGCCCAAAAAAAAAAAAAAAACTGAGGAAAAAATAGCCGG
GCCCTGTGGTGGGTGCCTGTAGTTCCAGCTACTCTGGAGGCTGAGGCAAGAGAATCACTG
AAGACCAAGAGCTTGAGGTTGCTGTGAGCTGTGATGCGACAGCACTCTAATGAGGGTGAC
AAAGTGAGACATCTCAAAAAAAAAGAAAGAAAGAAAGAGGCAAAGTAAACCTTCCCTATG
TACACCCCAGCCCAGGCCCCAGGCCTGGTCTGTATTGTGAATGGGGGAACATGGAGAAGG
AAAAAGAAAAAAAAAGAGCAGGGGTCCTGCTGAACAAGTCCTTACATGGTGTGGTGCCCA
ACTCAAGTCTGGAGTAGCTTTCCTCTCAGCTACAGGTTCAGGGGGAGGTAGCCCTGGAGG
CCAGGAGCTATGCAGATTGCAAGGGGCTGGCAGCTGTGCAGATCTGTCTATGGGACAGGA
TAGGGCTGCTGATGGCCTGGGCAGACCAAGTGCTCCTGACCTCTCCAGGGCCAAGGGGAC
TGAGGAGCACCACCTAGTATCTATAAGTCTGACCTACCTCCTCCTAACACCCTGCCTTGG
GGGCAAAGTCCCTTCCAGCTTAGCACATGGTGGCCTTGTTCCCTAACAAAGTACCATGAC
AGGAGGAGATGACAAAAGAAATCCATTCCCGGACGGCACCTGTGGCTCAGTGAGAAGGGC
ACCAGCCCCATATACTGAGGGTGGCAGGTTTGAACCTGGCCCCGGCCAAACTGCAACAAA
AAGAAATAGCCAGTCATTGTGGCGGGCACTTATACTCCCAGCTACTCCAGAAGCTGAGGT
AAGAGAATCACCTAAGCCCAAGAGCTGGAGGTTGCTGTGAGCTGTGATGCTACGGCACTC
TGCCCAGGGGGACAGCTTGAGGCCTGTCTCAAAAAAAAAAAAAAGTCTCCTGTATGGATG
GACCACATTTAGTTTATCCATCCATCCATTGAAGGGCATTTGGCTTCTTTCCCACCTTTC
GGCTTTTATGAATAATGCTGCTGTTAACATTCATGAAAAAGTTACTGTGTGGACATATGT
TTTCATTACTCCTGAGTATATACCTCGGAGTGGAATTGCTGGGTCATATGGTAACTGCGT
TTTTAACCTTTTGAGAAATAGCCAGATTGTTTTCCAAAGTGTCTGCACTATCTTACATTC
CCAGCAGCAGTGTATGAGGATTCCACTTTCTTGACATCCTGTCAACACTTATTATTTCTC
TTTTTTTTTTTCTTTTTGAGATAGAGTCACCCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved