Otolemur_garnettii Locus Mono:334:SNORA7
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:334:SNORA7
Otolemur_garnettii
Mono:334:SNORA7
GeneScaffold_415
SNORA7
1001..1138
2138
CAGGAAAGAACAGAAGAGTGGACTTTGGGCTCTGACTTTTTTTTTTTTTTGAGACAGAG
CCTCAAGCTGTTACCCTGGGTAGAATGCTATGGCCTCACAGCTCACAGCAACCTCCAACT
CCTGGGCTCAAGCGAGTCTCCTGCCTCAGCCTCCCAAGTAGCTGGGACCACAGGCACCCG
CCACAACGCCCAGCTATTTTTTTGGTTGCAGCCGCCATTGTTGTTTGGCGGACCCAGGCT
GGATTCAAACCCGCCACCTTAGGTGTATGTGGCTGGCACCTTAGCCACTTGAGCCACAGG
CACCGAGCCTGGGCTCTGATCTTGAACCTCACACCCTTTCCTGCTAGAACCAAAGGAGAT
GTGCTTTCCTCTCTCTGATTTGATCTTTCACCCCAGCTATTCAATCTTTATATTGCCACT
GAATCTCTTTGAGCCTCGGATGGCCCATCTGAACCTGAAAAATAATAATACCTGCAGTGG
AAGCACCAACTTGGAGGCTGGAGGCCTAACCACCCCTAAACAATCCCATCAGCCCCCCAA
AGCCTATTCACTCATTTGATAGACTATATATTTGGGGAACATCTCTAGAAAACCCATGTA
AGTTGTGCCTGATCCACACTCTATGACAATCACCCTCTGCCATTCTTTCAATCAGATCAT
GGTTCTAAGTACCCCTGTAAAGTAAGATCTACCACCTTATAGCTGTATGGCCTTGGTATT
TTCAACTATAAAATAGATGCCTACCTTATAGAAGAATTGCTGTGGGGATTATTCCAGACA
AGGTGACATGAAAGTGCGCAGTAAGCATTTATATGTTATCAATAAATGGGAGCAGTGAGT
ATAATTATCATCATTAAAATTATTGAGATACTGGGTGGCGCCTGTGGCTCAAAGGAGCAG
GGCATCGGCCCTGTATGCTGAAGGTGGTAGGTTCAAACCCAGCCCTGGCCAAAAAACTGC
AAAAAAAAAAAAAAAAATTATTGAGATACTTAAAACTACTCAACCTCCTAGGATTACGTC
TGGAGAGTGGCTAGTGTTTTACCAGCTTTGAAAACAGGAGGGAAAGGAAGCCTGGCAGAA
GGACCATTCCATCCCAGCTTGATCAGTAGCTGGAGACCAGAAGACACTCTGCAACAAGTG
GAAAGGGGGAAGAAAACAAAGAAAAAGAAGAAACTACTGGATTGGTGACAACTAAGGCCC
CTCAGCCCTCGCAGACCACACCTGGCCAGTGTACTCACGCATGTGTGCACTGGCACACAC
GCCCCCCAATACCCCACTCTTTAAGGCAAGGTCCACAGTCTCTGACCCCAGCCCCAGAAC
ACAGGTCATATGTTCCTGGAAACCATTCTTACCCACCCATAAAATTTCTCCCACTTTTCC
AGATCCCCAATCCTGCCTTCCTCAAGTTGCCCCAGCAACATCTCCTAAAATCATGTACCC
TATCACTGTATCATGAGATTGTTATACTCCTATAAAAGCATCAGCAGGAGTTGCCAGGAG
CAAGACAGGGAGAGGGCACAGCATGAGTAAAGGCCCTGCCATGATGACTTTCATTTCTCC
TCACCTGGCCTCTGCCTGGGCAGGTAGCATTTGCAAGGCTGGTGGTGTAAGCCAGAGGTG
GCTGCCACTGAGCAATGACTACAGTGAACCTAACACCAGCCCAGCACCTGCCCAGGCAAG
CCAATCTGTAGCCAGCCTGTGGAAAATGAGGATCCAAGCCCTCCCTTACAGAGACAGACC
TCAGGTCTGAACGAAGCCAGAATCCATACCACATCTTAATCACGTGAGCTCCAGCATTCT
GTTCCCACCTCCAGAAACAGGGAGCTCGCTCTCTGCTAAACACAACCCCACCAGCTTGCT
TACTCTGATTTTTCTCTAAGTTTCCTCATTACAGTGAGTTGAAGTTAGTCTCCCCTGGCC
ATCTACCCACTGGATTTACCTTCCAGTGCCTCATAGAACAAGGCCACTTCTGGCCAGAGG
AGTCCCTCAGAAAGCCGTAGACCTTGACTGTAATTCCCTGAGTTCAAACTTCTCCAGGCT
AAACCACCCATGTCCCTAAGCCTTGGTTGCCACATCTGCTAAAAAGGAATGATCAGAGTG
CCTATCTCCCCCTGCTGCTGGGAGATTAAATGAGCTCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved