Otolemur_garnettii Locus Mono:220:SNORA62
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:220:SNORA62
Otolemur_garnettii
Mono:220:SNORA62
scaffold_75660
SNORA62
1001..1134
1208
TCAAAGACTGCTTTTCTGTCAATTAAAATATGAAAATGAAGTAGCAAATAATTTGAAAT
CTGCTAAAAATATTGAGAGGACATAGTTAGAGCTTGGAGTTTAGGCCACTTTGGCCGTGA
ACTCACAAGGGTAGGTGGTGTGCTACATGCTAACCCCACAAGGGTCTCTGGCCCAGTGAT
GGAGTTTGACAGTAATCCTTGCTACAAGTATAGTGAAAAAATAAATACAAATATTGAGAT
GGTCAAAAGACTTTCTTCAAACCAAAATGAAAACAAAACAAAATTTTTCATATTATTTAA
AAAAATCTCTCCCTTGGAGGAATAATGGGGGGCCATTTTTACTCTGTATGCATGGTCTGA
CCCCAGGACCCTTCCTCTAGTGCTGGTTCTTCTCTTCTCAGCCTAGGAAGGCTGCTCCCT
GCCCACTTTCTAAGGGGCTGGTGGAGCATGAGATGGAACAGGATGGTGAACCTGGGAGGA
AGGGGCCAGGCCACTGCACTCGTGGTGGGGAAAGACACGAGCATCCTGTGTCACCGGCTC
CGACCACGCTCCAATCGACTTCTTTAGCTTTCTTCCATCCTCCCACTTCAATGCCATTTT
TATTTTATTTCATTTTTTTCTGCCCTTTTCACAGAGAAAAAAATGTATAGAAATAATATA
TATATAGTACCCTATGGGTATTGGAAGTTATTAAATGCACAATTAACAGCATTTAATGTA
GTCTTTGACTTTTTGTCCAACACAATTTGTGAGGGGAACTTAATTCAGTAAAGACTTAGC
AACATGAATATAATCTGTTGTGTCTTATTTTTATTCATCCAGGGCATAATTTGCACTATG
ATCATCAGCTAATGTGGAAACTTAGGTAAAAATATGCCCTGTTCAGAATATTTATTTCTA
AGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved