Otolemur_garnettii Locus Mono:316:SNORA11
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:316:SNORA11
Otolemur_garnettii
Mono:316:SNORA11
GeneScaffold_4699
SNORA11
1001..1115
2115
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GAGATGATGGGGGCCTTGATGCTGGTTTGGACTGCATGTCGAAGCTCACTGAGAGTGACA
TTAATCCCGAAATTGCTCAGAAAGAAGAAACCACCAAGTTTCCCAGAGAGGATTATAACA
ATGGTTCTCAACCTGATCAATTTATCTTAAGATATTTTTGAGGGGTGTGCACAGAGCAGA
GGGCCTGAAAAATGGCTCCTCTGTTCATAACACGCCCAGCAGAAATCGGGGTCATTGTGA
TGAGGGGCACAAAACTTGAACAAATTCCCTACATGTGAAGAAGAAGAAGAATTTGATTAA
ATGTATGTGGTGGGCGTAGGGCTGATCACTGTGTAATTCTTTCAATTGTAATGCTTTAAA
AATTGCCTAATAAAATATTGGAAAATTTTAAAAAAGATATTTTTAGTCATCACAACTGGG
TGGAGAGAGGTGGGGTGTTGCATCTCATATCTAGTGGGTAGAGGTGAGGGGTACTGCTAA
GTGTCACAGTGCACAATAAGGTCCCCCACCACAAAGAATCACCCCACTCAGAAGAACAAC
GAGACAACACCCATACTGTTATTCCAACTAACAGTCTCTCTTCTGCTCACAGACAGAGAG
AAAAAGAATGACAAGGGACAAAATATTACATGTAAATTTAACTAAAGTAACAACATTTAC
GAATCATGGCGATTTATGCAGAAACTGGAGTTTGTCATTCAACAGATAATTGCTGAGCAT
CTACTAGGTACGAGGCATTTAGAGACCTATCAATACATGGAAGAAACTTCTCCCCATTTC
CACCTCTCTCCTTTCTCACCCCACACAGAAGCAAGAAACAGCAGAGTGGGAAAAGCCGGG
GTAGGTTCAAAACATTAATTTGTACTCCTAAGAATACTCGTCAAATTTTTGGTTGAAAAG
GTCAAGTAGATTTTGGTAGAGAAGGGATAGTAAATAACAATTTCTTTCTTGTGAACACCC
ATGAACTCATATTTATGTTTCTGAAACTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved