Otolemur_garnettii Locus Mono:106:SNORA2
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:106:SNORA2
Otolemur_garnettii
Mono:106:SNORA2
scaffold_105635
SNORA2
1001..1121
2121
AGTAAAAGAAAAAATGAGGGTCTGAGCCAAAGTTGAGACAATGAGAATATGGAAGAGAG
GATGAATTCAGATGTTATGTAGAACCAGCATGGAGAAAGATGGGAGACTGATAAATCATG
GTTGATTCCTGGATTTTTACTCTCTCTAGTCATCATTTATAGAAATTAGACACTCACATG
TAGATTGTATGCCTCTTAAGATATGTTGTGTGTATACTTTGTGATAGGAATTCCTGAACA
AATGGCACCACTAAGTGTGTTTCACCATTTATGAATCTGTTATTAATATTTTATTATTGT
GTTCCTAATAGAACATGAGACCAGAAAGTCTCGTGGCAATTTTCAGAAAATCTGTGATCC
ATTACAAATTTTATATCCCACAAGAAAAGTTGCCAAACTCTATGAATTTCTTGAAAAGAA
GCGCTCATGTAACAAATTTTAGTTTAGCCATTATAGTAGGTAGAACCATTGCTAGATGTT
TCCCCATTTCTTTTCAGTATGGTGTTATTAATGTTTTGATATTAATTATTAAATACATAT
GAAATTATACTTATAACACATTGAAGATCTAAAAAATAATAACAAAAGGAGCCTCCATGT
ATTCCCCCACTCCACTCTAGAAATGGAATGTGACCAATACTTTGAAGCCTTTGGATGCTT
CTCCCTGATCTATTACCTTCCCTCTGCCTACATCGCTTTCAGATGACTTTATAAAATCTG
CTAATACAGAGTTAATTTTCTTCTTGCTTTTTGTTTCCAGTTTAACCACATATATATCAT
TAATAATGATCATTTTACATATAAATTAAATCCTACTTATGTACTTGTCATGTTTTTGTG
TGTGTGGCAAACAACATACTTCTTAGAATCATCCATGTTGATTCACATAGCTGTGATCAT
GCTTTGACTCTTTGATTACAAACACACCCTGATTTGTTTATCTATTCTTTTGTAGACTGA
TCTACTATGAACATTCACACTTTGAACATTCCTTCTTATCATATGATACATGACAATAGC
TAATCAATTGTCTTTTGCACCTAAAGAATTATCTTTCTATGGTCTGTTGGCTATTTCAGA
ACTTTGAAAATGTAATGGTCAATTCATTAGAAAGAAACAGTATGAGTTATTGGTGATAGA
TGTAGGCTAGTATATATTTGTAGTCTTAATATTGGGGTTCCAAAATATCTATAAAATATT
ATTATATTTATCTCAAGAGGATATTTAAGTTATTTGTTAGAATTATAGTGCTGTTAAATC
TTAATTACAGCCCCCCAAAATTACTGTGGGTTTTTACCCAAAATAAAAATATAATTCTAC
AGTAAAAAAAAAAAAAAAAAAAAAATTGTCTTTTGCTTAGAACTCCCTGTAGTATCTTTT
CCCATCATTGATTTTCAAAGATTTAAGACTCCTTATATTTAAAGGCATTTCTTATTAAAT
ATATATATACCATGATTCTCAGTCCATGTTTGCGTATTATGTATTGACTAACAAATTCAT
TAACTCCTGGAAGAAAAATAATGCTGTCAACTAGAATTAGATCATCATTGTTATAAGAAG
AAATGAAAGGTGATGCTACATTTGTAGAAAAAATGGAACTTGATTAACATGAGGTATATA
CTTAGAAACAAATAAGAGTCACTAGGAGAGAGCAAAATATAAACAGGAATAGTTCATACA
GAAATAGTACCATGTGATTTAAAAAGCAGTGGTTGCTGGGAGGAACTAAGAACCTTAAAT
GGAGGAAGAAGGAGAAGAGGTGGGATGAACAGGGCCTATACCTTTCCTGGGAGAAGGCAC
GATAGTGAAGAATACTCTAGTCCTGGAAGACTGCCTGGGAACACATGTAGCCAGGGGAAT
GGCATGTAACAACGGATATATGACTATACAGGGCCTAACAATGCATTGGATGCTAATGTT
AAGTGAAAATTAGCATAATTGTGGGTCAATAGTACCTTGGAAGATTCTAAGAGGTCTAAC
AGGACTGTTAGAATCATAATCTGTGAAGTAGAAGTATCTTTCTTTGAGAGCTTCACTAAT
CCTAGCTCCTTTGGTGAGCGCTGGTTCTCAGCCCCTCCATGCTTCCTGCTCCACATCCTC
CCGGTGAGCACATTTTCATTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved