Otolemur_garnettii Locus Mono:141:SNORA11
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:141:SNORA11
Otolemur_garnettii
Mono:141:SNORA11
scaffold_114390
SNORA11
1001..1109
2109
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCAT
GTAGCTGACTTTGTCCAAGGACTTGGTGAGCAAAGAATTCAGCCCAAGCCCGTCCCATCT
GAAGCATCTTCCACCTTTAACTAATTTCTAGAACAGAAAAGTGTTTTTAAATTTGTTTAT
GTTTTTTAAAGAAAACCGTAAACACTTTTCTTCTACAGAAAAGTGTATTCAGAATTTAAA
ACTAATAAAGATACGAAACAGGACTCTTGGGGTCATTGTGATGAAGGGCACAGAGCCTGT
GGCCTCCCTATGAACAAATTCCCTACATATGAAGAAGAAGAAAAAAATTATAAAATGTGT
GCGGTGGGTGTACAGGCAATTATTACATAAGTCTTTCAACTGTACTGTATGTTTGAAAAA
TTGCCTAATAAAATATTGGAAAATTTAAAAACAAATAAATACAACTAATGAAGACAAGCT
GAACTGATGCAAGGGGCGGAGGATTCTAGAAGTTCCCCCCAGGGGAGTGCTGTCCATAGG
CTGGCCTGAGGAATCCTAGCAAGATCTGCTAGGTCAGTATGACCAGAACTTTCCAAGCCT
TTGTAAAAAGCCTTACTGAAGCACACGTGGGCCCCTCCCTTGCCTCTCTGTCCAGAAGAG
TGGCTTTACACTTTGCAAGGTAAAGCTGGTCATTTCCCTCCCCTACCCGCTACCCTGCTC
TAACCCGCCAAAACTGAGTTGTCTAAGGAAGTCACCCAGCCCTAAATGGGCTTATAGCTC
TCTGTTTCTGGTGATTGCCATAGGACCAACCAAAAGGGACTTTTGAGCACTTCTTAAAAT
ACTGTATGTGCGCTACAGATCTGTGACCCAAATGCAGAAAGGTGAAAGGGCAGGAATCCC
TTTCCAAGAGCAGGCTGAGTGATAAATGTGCAGCTTGTGATCTCAAGTGTCTGTAAATTA
ATTGCCTCCCACAGCCTGGGCCGGCGGCTGCTCCCGGGAAGCTCCCAAGACTGGAGGAAC
ACGACAGTGGCCACGGCCTGATGCACAACCAGGGGTGTCACAAGAGGAGCGCTAGGGTAA
CAGGTGGCCACAAGTCTGGAGAGCCCAGGTACCTGCCTGGAGGGAATGCAGCAAGCTGAG
CCGGTCAAGCTGGCGCCAGTGAATGGATAGGCTTTCCGGAGAAGGGGATGGCGGCCAGGT
TACTCCAGCCCCTGCAAGCCAAATGACAGGTCACGCCTTCTTTGTCTAGTACCAGGGAAG
AAGAGACCAACTTCTCAGTACTGGTGAACAGTAGTGAATTTTCCCTATGAGACAACGTCT
TCAATTAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved