Otolemur_garnettii Locus Mono:384:SNORA42
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:384:SNORA42
Otolemur_garnettii
Mono:384:SNORA42
GeneScaffold_864
SNORA42
1001..1136
2136
CAGATTAATACGATGTAGTGTTGTGTAGTAACAGGCACTTCACATAAAGGAAGGTCATG
GAAGGGGATGATGGGGTCAGGGAAAGCTGAGCAGGAGGCTGAAAGAAGTAAAGGGGGGGT
AGATAGCTTTTTAGGGGAAAATATTCTAGGTCAAGAATTTGCCAAATCCGGCCCACCATC
TGTTTTTGTAAATAAAGTTTTATTGGGACACAGCCATGCCCATTCATTATGATTGCCTAG
GGCTGCTTTTGTACTATCATAACAAAAGACCATAATGCCCCTGAAGCCTAAAATACTACT
CTCTGGCCTTTTATAGAAAAGGTTTTCTGACTCCTCCTGTAGGTAAAGGGAACCCCAAGG
TCGGGGGAGCTGAGGCACATCACACAGGTGCTTAATTTGTGTGTCTCTCTGGGCCCCAAA
GTCAGTGGCGTGTGACTTTCCTAGAGGATCCCTTGAGGACAGTAATGCTGCAGGGCTCTT
CTGGAACACGAGCTAATGGAATGGGGGACTGTAAACCAGTAGCATTTCCCAGCTATTTGA
AAGCACTCAACAGGTAGCTACTGCTATTCTGGGCATTAAATTATTATCTTGGCCTCATGA
GTGCTCAGCAGGGACTGTGCAGAATCCTTGCTTATATTGTAGCCTGAACAGCTCTCTGTT
ATTTTTGAGGGGCCTCTCTTCTTTATCACACCAGCCCCCAAATCACAGAACCCTTCTTTC
TCACCAGAATGCCATTTGGGAAGTCAGAGCCCTGGATGCTTCACATCCTAATTCCAGGTG
GCAGGGACTCGGTGATGGCAAGGCAGATGCCGTCCCTACTCTTGGTAGAGGGCAGGCGGG
GGAGTCTCAAACTCAAAAGCTTACAGGGGTCATGGCAGGGAACAGGGAGTGGAGAGGGGC
AGGACCCACCTAACCTGTTAAAAAGGACACGTCCCCCCTCCCCGCAATCCTTTCTATTTA
ATTATCATTTTAAGATTGTGTTGGGTGAATAACAATTACTTGCAGGCTCATCTGGTCCCC
AGGAAGCCAATGAGCTCTTGTTTATCATAGTGCCCCATGCCAGAGCAAGCTGCGCCCCTG
AACCATTGCCTACCTCTGTGTCCATAGGCTGCTGGCACTGAAGTGGGTTGCACAGAGGGG
AAAAAAAAATGAGCTCTTGTTTATTTGGAGTCGAGATTGAGCGATGAGAGAGTTTAAAGG
AAGCTTCAATCAGACCCAATATTACCAAATTCATCCAGTGGCTCCAATTGTTATGTGAAC
TTACAGACGACGCAACCGAGGCCCAGGGAGGTTACATGAATACCAGGTGTCACCCAGCTA
AGACAGAATCATTGCAGTCCTTTACTGCAGCGCAGGGCAGAGAGACTGTAATTAACTGGA
CTCCTTGGTGTCATTAGGTGATGGCTGACATGAGTGTGCAGAGACCCCAAGGCACACATT
CTGAATTCACAAAACAGCACAGTGGGGCAATGAGTCACATTTCCAGCGTGAGCCTTCCCT
AACTGCATACCCTTTGAAACATTTCAGCATGAGGCTCTGCGGGTTCGCTGTCTATAGCCT
CTTGCTGAAGCCATCTGCTGGGGGAAATCAGGGTTCACCTGCGAGCTAAGAGGAAGCAGC
AGGCAGCCATCACTCTCATGCATTTTTGTTGAGTGGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCCCCAGGAGGTAAGTGGAACACCAGGAAAGCCTGCAAATGCAA
GATGAAGGGGTGATGTCTGGGTGAGGGAGGGGAAGAGGTCGGGAAGCGGAGAGAGATGAA
CCTCAGCCTGAAGCAGGCAGAGCATGATTGGTTTGTTGCGGGGAGCTTGGTTTTACTTTT
TCTGTACCATTATCTTGCCCAAGAGTTTTTTGTGTTTTTCTGTTGTGTCTGTTTTTTGGT
TTTTTTCGAGACAGAGTCTTACTTTGTTGCCCTCGGTAGAGTGCTATAGTGTCTCTTGGG
CTCAAGCAATCCTCTTGCCTCAATTTTTCATTTTTACTAGAGACAAGGTCTCACTCTATC
TCACTCAGGCTGGTCTCAAACTCCAGAGCTCAAGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved