Otolemur_garnettii Locus Mono:476:SNORA11
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:476:SNORA11
Otolemur_garnettii
Mono:476:SNORA11
GeneScaffold_843
SNORA11
1001..1105
2105
AATGTTTCTATTTCTAAAGTCTTAGACACAAATTATTTCATGTTTTAGACTTTTATTGC
CTTAGTAAATTCATCAGTCATATAGTTTTAAAAACGTACTGCCAAACTATTTTATATAAA
ATTACAAGTACAATCTTAAAGTACTTAGAACACAGAATTCCCATCATTGATATTCACAAA
GAATTTTTTTAAGGCAAATTCCAAGTGCAAAAGCAATGGCACCTCTTCTGAAGTTCTACA
ATTAGTTTCAGGTTTTAGATGTTAAAATACTTATATCTTTGTGTTTGAAGATGCAAAAGT
TAATCAACTACTAAAGGTGAAAATGTTGCAAGAAAAAGAATGTCTTTGTTCCACATTTTT
CATAACCACCTTGCTTATGCTAGTTATAGTCTCAATTTAAGACTACTTTGCATTTGGTCC
TTTGTTGTAGTATTCATATTACAGCATTTAAAATAAAGATATTAATGCAGAGGCTGCCTC
CCACAATTATCAAATATCATCTTCCATAAATAAGCAACTGGCATAATTGCAGATAGTCAA
TAATTGCTGTTTGTGATTAAAGTGATTCAATCAAATTACAAAATTATTATTTTATCAAAA
TATACAATTAACACAGGAGAAGATGTTCAATAGATAAGGATCCTGGAACCTGGAAGTGAA
ATCGGAAGTTATCAGAAGAACCCCTATTTACTGAGGACGCCCTCTGTGCAAGGCACTGGG
CAGGCTCTTTCACAGTCTATCTCATTTTAAACTTGTCCAAAACCCAGTGACTCTGGGAAA
ACAATTAATAAAACATTTGTCAAGATGGTTGGAAATAAGATTAAAATACAGAAAAGCAAA
GGAACATGTAAACAAAGAAATATTCCATTTATATTAGTGATGAGTTTACTAAATACCTAG
AAATAAATTTAACAAGACAGAATTATAGGAAGAAACCACCAAAATATTTTTGAAAAATAT
GAAATATCTGAACAATTACAAATTCATTTTATATTCTGAGAAGGAAAAACTTATCATAAA
AAATGATAAAACCAATAGTAATCTGGAGTCATTGTGATGAGAGGCACAAAACTTGTAGCC
TCCCTATAAATAAATTCCCTACATGTAAAGAAGAAGAAAAAATTATAAAATGTATGTGAT
GGATGTATGGTTGATCACTGTATAATTATTTTAACTGTTGTATATGTTTAAAAAATGCCT
AATAAAATATTAGAAAATTTTTAAAATGCTAAAAACAAATTTGATGCAACTTCACCTAGC
ATTCCATCAATACATTTTTTCCAACAGAATGAGTCTATTTTAACATTGGTACCAATAAGA
AGTTAAAATGATAAAGGGAAAAATTAGCTAGCCATAGCCAAAACTGAGCACAGATTGAAT
ATTTCTTGATTTTGATTTGGTATTTATGAGAGACTACTAGCACTTAAAAATACTCACCAC
TACATTATTTACTATTACCAAAATCAATACTAACACAAAATATCATTTTTGAATTTAAAA
TGACTTAATTTTTCCCTTGAATTTCTCACATCAATTATTTCATATTTGGAAAATGTCTTA
AAATCTTGTATATTTTATTTCTGGCAAAATTGTCAAAACAATATGCTTTTCATTGATAAA
CATCTTTATGATCTCATCAGAATTCTCTTTTTAAGGAAAAAATGCCTATTTTTAACTATC
ACTTTAATTCCTTCATCATGAACAATACTTGATACACAACAACTACCAATTAACTTCAGA
AAAAGAATATTAAAGAATATTATTCCACATTGGGTATACACTAGCTTTAATGCATGAGTT
TAATAGCCTCATGTCTATAATGGGGATTAATCTTTAGAACACTTTATTTTGATTAAGTGA
AAAATATAGCCAAATATTTACAGATTCTTAAAAGCATTATAATTGCAATCTGACTTAACA
TACTAAGTGGAGATAGCAACTCAACATATATCTCCTAGGACTATGATGAGAACATAGTAA
GATGATACTTATAATGAATTTAATGTGCATAGGATATATCAAATATAAAGTGCATAGCAT
ATTATTTCAAAAAAATTAATAAAATTCACCTAATAACTTTTCTTTACTTCTCTCTGAATG
TGAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved