Otolemur_garnettii Locus Mono:430:SNORA11
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:430:SNORA11
Otolemur_garnettii
Mono:430:SNORA11
GeneScaffold_1138
SNORA11
1001..1090
2090
CTCTCTTAAACAATTCAAGGATTCATTCCACCAAAAAGCTGTTCAGAGGCAGGTGATAT
AAGGTTGCGAGGAGAAATAGCATTTTGGACAGGCAGAACAGGGCACTGGGAATCCAGAGT
CAAGGATTCTGATCCCCCTGCACTACTCAGGTCAGGGATTTACATATAGTAAAGGTTCAA
AAAATATTTTCTAAATGAGCAGTAGACTGTCATAGACTTAGAAAATCACTTAGCTTCCAC
AGGGCTCAACTGTCTCAACAAACTAAAGAAAACTAGATGATCCTTAAGACTCGAAATAAT
GGCTTGGCGCCTGTGGCTCAAGTGGATAAGGTACCAGCCACATACACCTAAGGTGGCGGG
TTCGAATCCCCAGCCCGGACCCGCCAAACAACAATGACGGCTGCAACCAAAAAACAGCTG
GGCATTGTGGCGGGTGCCTGTGGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGACTCGCT
TGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTGATGCCACAGCACTCCACCCAGGGAGA
CAGCTTGAGGAGCTGTCTCAAAAAAAAAAAAAAAAAAAAAAAGACTCCAAATGATAATGA
TTCCAAGCTGTTTTGCTTAAAGTAGAAATTCACCGATTAGTTGCATCTCTCTGTCACTTA
GCTCATTCCTTTGCTAACCTAACCAGAGAGCTTTTATTGCTTTTCAAATTCAGGACAACG
TGAGTTTTATTTATTTTCCCCAAACTTCCTAGAAACAGGAAATCCCTTGTAGATATGCTG
TCTCCTATATTTGGAAATGTACAGATGGATACAGGTGGTAGAATCTGAAAGGATGCTCTC
CTATAGATGTGCATTTCTGCAGGGGAGTAGAGCATGAGAACTATTTGATGTGCAGTTTCA
TCTAGGAAAAAGAAGATCACCTTCTGATCTTTTCTAAATCAGCACTAGATGGTTATCAAC
ACCCATTAAAATCCTTATGAAAAGTGGTGCACTCAGAGCAAGGGGCCTGAAGAATGGCCC
AACAGGAATCTGGGGTCATTATGATGAGGGCACAAAACTCGTGGCCTCCTATGAACAAAT
TGCCTCCATGTAGAGAAGAAAACAATCATAAAATGTATGTGGTGGGTGTATGTGTGATTG
CTGTATAATTCTTTCAACTATACTGGATGTTTGAAAAAATGCCTAATAAAATATTGGAAA
ACAAAAAAAATCCTTATGAAGATGTCAGCTTGGCTCGGTGCCTATAGCTCAACCGGCTAA
GGCGCCAGCCACATACACCTAAGGTGGCAGGTTCGAATCCCCAGCCCGGACCCGCCAAAA
CAACAATGACGGCTGCAACCAAAAAATAGCCAGGCGTTGTGGCGGGCACCTGTGGTCCCA
GCTACTTGGGAGGCAGAGGCAGGAGACTCGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGA
GTGGTAATGCCATGGCACTCTACCCAGGGGGACAGCTTGAGGCTCTGTTCCCCCGCCCCC
CAAAAAAGATGTCAGCTTATTTGGAGCTAGGTGGAGAGATTAAATCCAAATCAAGTCAAA
AACAAATAAACAAACAAAAATCCCAGGATCTGTGCAAGTGAATAGAGAAGGCATCTGTAC
TGAGCTGAATAGTGTCCTTTCCTCCAAAGTCATATCCACCTGGAATCTGTGAATGTGACC
TTGCAATGGACTAAATGCTTGTGTTCCTGCCCCCCAAATTCACATGCTCAAATTCAAATA
CTAAACGTGATGTATTGGGGGTCTTTGGGAAGTAATTATGTCATGAATGACTGATGTTCG
TTCCCTTACATAAGGGACCCCAAAGAGCTCTTTTCATCATGTGAAGATACAATGAGAAGC
TGGCAAACTGTAACCCATAAGAGAGCCTCCCCAGAAACTGACCATCCTGGTACCCTGTTC
TAGAACTTCCAAACTCTGCAACTGTGAGCAATACATTTCTGTTAGGAAGCCACAGCCACC
CAGTCTGTGGTACCTTGTTACAGCAGCCCAAACTGACCAACACTGATTCTATTTGGAAAT
AGGATCGTTGCAGGAGGGATCAAATATGTCTGTATATGTGATTAAGAGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved