Otolemur_garnettii Locus Mono:224:SNORD57
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:224:SNORD57
Otolemur_garnettii
Mono:224:SNORD57
scaffold_76824
SNORD57
1001..1063
2063
TGGTCCCAGCTACTTGGGAGGCGGAGGCAGGAGACTCGCTTGAGCCCAGGAGTTGGAGG
TTGCTGTGAGCTGTAATGCCACGGCACTCTGCCCAGGGTGACAGCTTGAGGCTCTGTCTC
AAGGAAAAAAAAAAAAAAAAAGAATGGTGCCCACAGACAGGACTTAGGCACATCTGAGGC
CAAGTGAGCAAGGAGCTCACTGCTAGTGGTGGGCAGCAGTAACGGGGCAGTGTTATCCTA
AGATGGGGTGAGGGGTGTTATGGGACAAAGCAAAGAATCTTTTGTTGATGTCATTAACAA
CTGAGATTTTCAGCATGGGAGAAAAGAAAGATACAAATTAATCAAGTACTATTCAAAACA
AAACAGAACAAGAAATCCTATAGCACTGAATTTGACCTGAAAGTACCAGTGTGAGCTCAA
AATGTGTTTCATCTTATAAAAAATGTCCCAGTTCTGTCTGCAGCAAATTCCTAGAAATAG
CAGCAAATCTGAGAGCAATAAGGCACAACTAGTGCCCAGAATGTGGTCTCTAAACAGTTT
CTAACTAAAAGGAACCAGAGCTCTGGAGAAGAACAGACTCCAGGTCTGGGCAGAGAAGAC
CCACGTCAAAGGACTCAGGAGGCGTCCCGAAGAGGCTCCCGCCTGCCAGAGACGGAATGA
CTCAGGCATCCATCAGACTACCACCGATTCCTGCCTGAGATTCTGGGGTCATGTCCAACA
AATCATTATGAAGACCAATGTCAAGGAGCTTTCCTCACGTTTTCTTCTAGTTTAACCATT
TCAGATCTTACACTTAAGTCTTTAATCCATTTTGAGACAATTTTTGTTTGTGGTGTGGGA
CAAAGTCTGGTTTCATTCCTTTGCATGTGGATGTCCAGTTTTTCCAGCACCATTAATTGA
AGACTCTTTCCTACAAGAAGAGTTTTTCTAAGTCACATTTGAAGCTAATTTTGGGCCTCC
TACCCACCACATGCTCAACTGTTCTGTCTTTAAAAGCCAGAGGTGATGAACTGTCTTAGC
CTGACCTTACAGAATGAGGCAAAAACCTGATTTAGTGAGCTTGACACAGAGGCTCAGAGA
GCCAGGGGTCTGCAAGCTTCTTAGCACCTTCCACAGGCAGGAGGAGAGCTGGAGGAGGGG
CAGGCTGGGTGGACTGGGTCACTCCCTCCCCTGAGGGAAGACTGGTCTGAGCGAGGAGAG
AAGCAGAAAGTAAAGTGTGCAAGTGTGTATGTGTGTGCGTGTGCATGTGCGTGTGTGTAC
ATATGTACGCAGGGGTACAGGGGGACCTGGGGGAGGAAGGATGACCAGGAAAGAGAGGGA
CGTGGGAAAGGGAAAACAAACCACAGTTAATGGCTATGCACTTATGAGGGAGGCCAAGTG
TGTGACATCCCTCTTGGCGCAACACTGCCTTCTCTTCTCCTGCCTTTTGACCAAAGCAGA
CCTTTGTCACCGGCTACCTTATCTGAGGCACTTTCTATAGCACTTCCTAAGCTGTGCTGG
AGCCAGAACTGAGCCATCTTTCCCAGTCTGGCAGACACTCCCTTGGTGGGCTGGGCTGGC
CTCCAGGCCCCGACAGTATGAGGCCAGTTTTCTTTTTTTTTTTTTTTTTTTGGAGACAGA
GCCTCAAGCTGTCCTCCTGGGTAGAATGCCGTGGCATTATAGCTCACANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCGAACCCGCCACCTTAGGTGTACGTGGC
TGGCGCCTTAGCTGGTTGAGCTATAGGAGCCGAGCAGAGGCCAGTTTTCTTAAGTGGGCT
CTGTCCAGTCCAAGGATTGCCGCAGCCTTCCCACCTCCTGTGGGCAGGTGTCCCGTGGGC
AGCTACAGGGTACTCTGGGCTCTGTGACCACTCTCCTGGTGGCGAATGAGCCACCCAGAA
CCTCACAGCAGACAGGCTACTGCGGTCCTAAAGCCCTGAGCTCCCCAGTGCAGGGCTGAG
GTGCCCACAGAGTAAGTGTTGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved