Otolemur_garnettii Locus Poly:19:SNORD78
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:19:SNORD78
Otolemur_garnettii
Poly:19:SNORD78
GeneScaffold_1615
SNORD74, SNORD75, SNORD24, SNORD77, SNORD44, SNORD78
1001..1078, 1417..1477, 1638..1719, 2001..2068, 2309..2369, 2605..2669
3669
GGAGTGCTCAGGTGAGAGCAAAGGACCAGGAAGGGGGCGGCGCCCCCGGGACCCGGTCC
CGGCTGCAGGCAGACGCGGGAGGGGAGCTGCCCGGAGGTGGGTGTGCGCAGCTGGGTGTG
TCCCGGCTGCGGTGGGGGAGGGGAGGGGAGGGGCCGCCCATCCCGGGGTCCTGAGGGAGG
GGCCGCGCGGAGGGGGCGGGTCCTGCAGCTCTGCCCAGCCGGGGGGCAAGGAGGTGGAAG
GTCGCCGGGTGCCTTGAGGCGGGGTGAAGGGAAGTGGCTGAGCGCTCCAGGAGCGGGCAG
CGGCGGAGACGGGGCGAGGAGTTCCCGGTGCAGGGGACCAGGACCGGGGTGCGGGGCCCG
AGCCCAGTCAAGGTGCAGCACCTACCTCCGGGGGTGGAAATGGGCCGGAATGGGCCGGAA
CACCGTCCCGGAAGTGAAACCCCCCGCCCCCTCCCCCAGAGCGGGCGACGTGCCGGAAGG
AAATCACTCACCCTTACACCACCCCCTTCCCCCTGCCCCGGCGCGTCCCGTGCCTCGCGC
CCCTTCCCCTCTCAGCTCTTCCTCCTCGGTCGGAGGAGCGCGGGAGCCCTGCGTCACCCG
GGCAGTCTTGTCTCCGCCCACCATGGCATTGTAGGGCGTGGCCAAGGGGCGGGCTTAGAA
AGGCAGGAGGAGGTGGAGATTGAGGGAGGAGAGAGAAAGCGGACGCTGGCGGGACGGTGC
GTCGTGACGTCATCAAAAGACCCTTTATATACGAGCGCCCGGTCGCCATATCGTTCTTTC
GACGCTAGGAGTCTTGTCTGTGAGTAATGTCTGTGTTAGTGTTAAGTGAGTCAGTGGTTC
GGATCCTTGAACCTTTAACTCTCTCAAGGGCGTACTAGGCTAGTCGCGCGTCTCTACTGG
GCCCACAAGGTGAGGATGGTGAAGGATTGCGTATTTGGTGCAGGCGCGGCATAGATTGAT
ACTCGGTTTTGGGGCCGAGCGGCAGACAAACCTCGGCTCACGTGCCCTGCCTCTGATGAA
GCCCATGTTGGTAGGGACATCTGAGAGTTGATGAATGCCAACTGCTCTGATGGTGGAGCA
TGCCGAGTTATCTAGATGGAATTTTGAATTGGACGCGGCTGGAACTTCCAGCCACTTGCT
CTCAGGGAGACTGGTGGTTTTGATAGTCCATGTGATTCTCTTTAAGTGGCTACAGTTCTC
AGTACCACTGTTATTTGTGCTGTCCTTCGCCTATCGTGCAGCAGTTATGGGTGGTAAGCG
TCATCTTGGTCACGATGGATTAAACGTTTGCATCTCATTGTTTTTTAGGAATGGTGGTAG
GCTTGGATGCATTGTGGCTTTCGATGACATGTTGTGGACAGGTAAGAGTGGGCAGAAATT
AGCGGAGGCCAGATTTGCTGAAAAACGGTCTTTATTAAGCCTGTGATGGTTTTAAGAGTA
GTGGACAGAAGGGATTTCTGAAATTCTATTCTGAGGCTTTAATGTGTGAGACGTTGATAT
TTAATATGGTCACAGTGAGGTTGTTCTAACTGTTACGCATCTTCCCTGTTTTCTAGCTGT
GTGCCAAAAGAATGAGAGTACCTATGGAGGTAAGTTACTGAAACTCTCTCTGAGAGGTAG
TTAGATCGAAAGTCAGTGTGCCACAATGATGACAGCTTATTTGCTACTCTTGACTTAAAG
AATGACGAGAAATCTTACCACCGTTATCCTAACTGAGGCACACAAAATGGTGATCTGGGA
AGCATGGAGATTGCACCTGAGTTAATGTGAATTTGTTTTCTCAGGTCCTAAAGAGCAAGA
CTCAGTGTGGCTGTGAGTGTACAGGTGAGAAATTCTGTATATGTACAAAATCTGTATTCG
TCCAGTACTTTTCACTATTTTTTTGAGACTAGATTACTAAAACAGTATTGAAGCTTATGC
ATTAGAAGAATTTTTGCTTCCTGAAATGTAAAAGGCTATTAACTCGCTAAATTTAGTATT
GGAGGAAACCTGAGGAAACAGATACTATGATGGTTGCATAGTTCAGCAGATTGAATCATG
AAGAAATTAGCCATTTGTCTGATGTATCTGGGGGTATATGGGGCTTGCCGATAGCAGTAC
ATGTAAAGCACCTGTCTGCTTTTACAGTCAGTGTTTAATTTGTTTTTAAAATGTGTTTTG
TAGGCACTGGCAAGAAAGCTGGAAGTTGAAATGGTAAGTAAAATTAATCCAGTTATGCAT
AGGAACTGGGCAGGCTGCCTAAAGTAACTGTCAGATCCTTGTCCTGTTACCCTTACATTA
GTAAACACTATGAGAATTGCTTAATGCAGCCTGGATGATGATAAAGCAAGTACAGACTGA
AAGTGAAGTCTTAATTAGCTCTAACTGATTTCAGGCCATTTTTAACCTTGAGGGGAAAAG
ATGGATGTGTAGCTATTCTAAAACCACTCTTTCATTTCTTAGGTGACGTCTGACTTGTCT
GGACCAGTTTAATTTTTTTAGTAAGTATTAAATGGAAATGTTGCAGTAGGCTTAAGACTT
GATACTGAGCAAGTGGCTACTTGTGAGATGTACCAGTATAGGTTTAATGAATGCTAAGTG
TTTGTGCATGCTCTGAACAGGGTTTTTGTAATGATGTTGATCAAATGTCTGACCTGAAAT
GAGCATGTAGACGTATTTAATACTGAAGAAACCCTGTAACAAACAACTTGGAGAATAGTT
CAGTCATATGTAGCATTTTAATGAAGGTCTCATTTTTCTTTTTTAGCTACTGGATACTCG
TTTCTATCCTGCAATGGCTTACTTGGTAAGGCAATACCTGGCATTTTGGTATGTGAGTTG
GGGTCTCCTGTTAAAGCCAGTGACAAATTTGAAAATGGACAAATAGTACTAAATCTCTGT
ACTAAAGTTAGATAAGTCATCAAATAAATACTTTTTTTAAAATTTTTTCTTTTTGAGACG
AGCCTCAGCTATCCCCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved