Oryzias_latipes Locus RPL17
snOPY snoRNA Orthological Gene Database
Oryzias_latipes RPL17
Oryzias_latipes
RPL17
scaffold2259
SNORD58, SNORD58
3292..3358, 4238..4302
5446
TTTACGCATCTAGAATTTACCCCAACTAATTACAACATTCAGAATAAAAACATTCAAAG
AAAAGATGCTCAGTCGTTTCAATGTCATCGTGACAAACAGAACAACAGTTTTCAGGATTC
CAAACCGTTTTCTTAATAATTCCTTGGATGGATAAATACCTGAAAAGGTTTGAAAGTGGA
CTTGGCTTTAGGAGGGATGGGGGGTTTGAAATATTTCCTATTTGTTTCTTTTCTGAAATG
TTAAAATATTGGGTCATATAATTAGATAATAAGATGTAGGGAAAGGACGTTTCATTCAAA
TATTCTCTGATTTGACGGTTGGGGGGGTTGGACGTCGCTATGTTGTGTCCATTAATCAGA
ATCTTGGGGACAGGAGGACGTCTGTAGATGACATCATGAAACAGATCAGAAACTGATTTA
CAACATTCTGATGAATGGCCTTAATAATGTTTTCAACATCTTTTCTATTTGTTAGTGAAC
CATATTTAGCTGTGAAATCATCAGCAGACATGAGAGAAGCATCGTCATTAAGAAGATGCA
TTAAAGACCAAATTCCATTTCAAACCATGTTGGAACACAGATGGATTTGTTTCTAACAGT
GACGTATCTGCAGTTCCATAGAGGAGTGTTGTCTGGACTGGAATGATTTTTCATTACAGG
AGAACTTGAATGGGAAGTTTCTTATTGTCAAAATCACAACTGAGTAAAAACTGGATCCCT
CCTAGGCGGGAAAATATTTTATTAGGAACAATGAACCAAATACTATTTAGATTTATAATA
AACGATTTTAACCAGTTTATTTTTAAGGTGCCATTAAGGCTGTTAGAGTCTATGGCTTGA
AGACCTCCATCTTCAACCACGTGATGTCTCCTCTAGCGAAAGAACTCATTGGTTTTCATG
GTTGGAACGCCCTCTGTCGGCGGGGCTGCGTTACTGCAGAGCGTCCTCCTCCCGGCCGGC
AGGGGGCGGTGCTTCTGGCAGCCTGAACAACAGGAGGAGCTGCGCACGCGGGACTTCCTC
TTTCCTGTGCGGCCTCAGAGGTGGGAGCGCTGTCCTTCTCCTCTCATCTCAATCTGTCGC
TAATCTGCCTCTAATTCGCGCCATCCTCCTTTTTAATCTTCGGTGTTCGGTCCAGAACGT
TCGGGATGATGATCTCAACACTGTAGTTTGTGTGCAGAACCGCGGGTTCTGCTGTTGACG
GTTTCTCGGGTTCTTCATGCTAACGCTGCTCCGCCATGTTGTTCGGTTAGAAGTGGGTTT
TTAGTCTTGGCGGTTCGGTTCGCAGAGTCGGAGTATTTTGAAGATTTTACCGCCTGCAGG
GTGAACTGGTTCTGATGGGTTTTAAGCTGTGAGCCGGAGAACGCACAGAGGCTCACGGGG
AATGTTTTAGCTGAAGTCGGCCCGGTTCCGGTTCTGTGTTTGAACGTGTCGTTTCTGTTC
CGCAGGTGTCTGAAAATGGTCCGCTACTCTCTAGACCCCGAGAACCCCACGAAATGTGAG
TATCTGAAGGGGGTTCGGGCTCGATTCTGCGGCTGTGATGATGGATTTCATGAAGATCTG
GGCTGTGCGGTAACGTCTGCTCTGTTTTTCAGCGTGTAAGGCCAGGGGCTCCAACCTGCG
GGTCCACTTCAAGGTAAGACCCGGTTCTGATAGGCCAGCTGTGTTTGGGTCGTGTAATTC
CAGCTGATGGAGCAGAAACATTTTTTTTAAAGAAAACTTAATTGACAACTGAACATGCAG
ACAGTTTGAGGTCCAGTGGGTCTCATGCAGTGGTCCTCTTCAGGCTGGGACCGGTTTAGT
GTCGGGCTTTCCACGGGCCGGTCCAAACGGAACCTAAACTGGTTTTTATTTATTTAGTTC
TGAAAATATCAGACGACTTTAAAAGTTTAATAAATAATTCAGGTGAGATTTGCTGAATGT
AAATAGTTACGTGTCAATAAATGTATTTTCATAGAACAGCATTAAAACACTGAGAACTCA
GAGTCTGATCACGGCTCAGAGCAGAAACATTTAACATGTTTAGTTTTTACATGATTCTGT
GAATTTTTATCACAGGAACACTTTCTGCACTAACTTTCTTAGCTGCTGCCTAATTCTCCC
TAAATCTCTGTACGACAAGTTTCCTCAAACGTCTTCAGCAGGTCGACAGATTCATCTGAA
TCTGTTAAATGTTTACGGGCTAGCGCCTACGGGCTAGCGGCTAGCGCCTAGCAATGACCA
ACTTTTTAGGTTGTCAGATGAAGTGAACCATCTGATGTTCAGGTGGATTTTCTGAACATG
AATCCTCTGGATCTGGACTGGAGAATCGGTCACTGCGTTAGGCGGAGCGGCGTCTGCTCC
AGGAGATCAAGTGTCTCCATAAAACTCCTAGTTTGTTCTGGAAACTTCTAGTTTATGGTC
CTTGTTGGGTTTTTCAGTCCGACTCTTTTTGTCCCCAAAGACACTTTCCAAATACATTTT
TGCTCTCGTGGGCTTTGAGCTGCAGACTTGGCGGTCTGAGCCACACCTGAAGGTCACGTG
AGGCGTTGAGAAAAGATGTGGTGAACAGAGTCCGGCAGTTTTTCAAAATAAGAGTCAGAA
AATAAACAGTTACCGTATGGATTTCTTTTTGTCTGCGGCCCGGTACCAAGTGGCCCATGG
ACCAGTACCGGTCCGTGGGTTGGGAACCACTGTTGTAATGTACACGTAGAACTGGATGTG
ATAGAACCTCTATGATGGTTACCCTGATCAAGACTTTATTCAGAAACACACAGATTGGGT
CTGATAGAATTCTAAAGGTTCTACTGTTCAGTATCTGAGCTCAGTTTCCTTTGTTAACAT
GGAAACATGGTTCCTCAATGGACCGGAAACCAGCGTCTCTAGAAGAGTTCTAGACCTCCC
TCTGACCCGAGGCTCGGTTCTGGAAGGAGGGGTGTGGGATCAGGAAGTCACATGACCCTC
AGTGATTAGCTGACCTGAAAGGGCACGGTGGCCCCGCCCCTCTTTAGAACCGTTTAAACT
GAGCATGCTCCTCGGAGTGGAGCCGGCCCAGGGGTGGAGTGTCTGTCTTGTGGGTTTGAG
CCCACAGGCAAGCAGATGGTCTTAGTTTGGTCCATTCCCACTCCTCTCTCTCCTGAACAG
AACACCCGGGAGACGGCTCAGGCCATCAAAGGCATGCACATCCGCAAGGCCAACAAGTAC
CTGAGGGACGTCGTCGTCAAGCGACAGTGCGTCCCCTTCCGGCGCTACAACGGCGGCGTG
GGCCGCTGCGCTCAGGTGAGTGCGGGCTCTGTGCGGACGCTCGGTTGCAGCGCTGCAGTG
ATGACCTTCTTAGGACACCTTTGGAATAAAGATGAAAAGACGAAAGAAAGCTGAGCAGTG
CGTCGGTGGGAGGAGCTCCGCCCGGTGGGAGGAGCTCCGCCCGGTGGGAGGAGCAGCGAC
TTCACTCTGATGTTCTCCACAGGCCAAGCAGTTTGACTGGACCCAGGGCCGCTGGCCCAA
GAAGAGCGCCGAGTTCCTGCTGCACATGCTGAAGAACGCCGAGAGCAACGCCGAGCTGAA
GGTGAGCCCCGCCCACACGTCACATGACCGCTGCGTCAGGATAGTGAGTGACAGCTGACA
TAGTCAGACTGTATAGAGAGCTGGACTGAGTGAGTGTGGGGACCCCCCCCCCAATATGAA
ACTGGTTTATTTAAAACTCCAACCAAATGAAACGGTCGTCATGTTTGCAGTAAAAATGCT
GTGATTGGTCGAAGGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTGGTTCTCTGTAGCAGTCTGTGGAACGCCAGGGGGCGGGGTCTACCAGTTTATACCCT
CTGCTACAAGTCGGTCATGGCCCTACAAACGTCTGTGACCTAATTGGACCAGCGTCGCCA
TGGCAACGCTGCGCTGGCACGGCCACGCGTTTCTCAGATTGCAGCTGAGACGGTCCTGGG
TTCCTGCAGAACCTCCTGCAGCTGACGGTTCCTGTTGTGGTTCCAGGGTTTGGACGTGGA
CTCGCTGGTCATCGAGCACATTCAGGTGAACAAAGCGCCCAAGATGAGGCGGCGCACGTA
CCGCGCGCACGGCCGCATCAACCCCTACATGAGCTCGCCGTGCCACATCGAGATGATCCT
CACCGAGAAGGAGCAGATCGTCCCCAAGCCGGAGGAGGAGGTGGCCCAGAAGAAGAAGGT
GAGTTGTGAGCGCGCTCAGAGCCGCTTCCCGCCGCGCGCTGCAGTGATGACCTCTTAGGA
CACCTTTGGATTCTCCATGAAAACAACTTCTGACCTGAGCAGCCCAGGCGCCGCGGCGAA
GCGTGTTGCCTGTCCCGCCAGAAGCTGACCCGTTCTCTGTCTGCAGGTGTCCCAGAAGAA
GCTGAAGAAGCAGAAGCTGATGGCCCGCGAGTGACTCTGAATAAAGTTCTGCTCAAAGCA
CAGCCTGGTCTGACTGTTATTAAGCCCCGCCCCTCTGAGAGCCATATTCACTCCCACAAT
CCTTTGCTGTGAGTTTCAAATGGTTTGAACCTGTGTGAAGGCAAGGCAAGTTTATTTGTG
TAGCACAATTCGTACACAAAGTAATTCAAGGTGCTTCACAAAACAGAAAAATGCATTAAA
ATCACAATACATCATAGAAATAATCAACGTAAAATTTACTTTAAAAGAAAAGAGAAAATT
TGAAAATTGATTTAAAAAATAAAGGAAGGAAAGGAAAGAAAAGTGCAGGTAGGACCTTTC
AGTCATATACGGCTAAACAGAAATGTTTTAAGTCTAGATTTGAACATGAACACAGAAGAG
GCCTGTCTTACGACTTCAGGGAGGCTGTTCCAGATTTTAGCTGCAGAATATTGAAACGCT
GATTCCCCTTGTTTAGTTCTGACTCTGGGAATCAACAGGAGGCCGGCCCCTGAGGTCCTC
AGAGTACGAGATGGTTCATATGGCACTAACATGTCAGAGATGTACTTTGGTGCTCGGCCA
TGGAGAGACTTGTACACAAGCAGAGCTGCTTTGAAGTCTATTCTTTGAGGTACAGGGAGC
CAGTGCAAAGACCTGAGCACAGGACTAATGTGATCATACTTCCTGGTTCTGGTCAGGACC
TGAGCAGCAGCATTCTGGATGTACTGAAGCTGTTTTACAGCTCGTTGGAGAGGCCGGTGA
GCAGGCCGTTACAGTAGTCTAACCNNNNNNNNNNCTATGGGTAGCTGGGTTGGAGGGTTA
GTTAATCTGTTAACTGTTGTGAACAGGACACGAGAGTTGCTGCTGCAACTTCCAATGATT
TCAGAGAAGTACCTTTCCCTTGTTCTGCATAAGATCTGGTTATAAGCGTACAACTCCCCC
TTATACATTCCATAATGAACCTGGAGTTTTGACTTGCGCCACTTTCGCTCAGCTCTGCGG
CACTGTTGTTTCTGTGCCCTGACTAGATCATCGTTCCTCCAGGGAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1445..1494, 1592..1632, 3120..3254, 3442..3540, 4006..4197, 4366..4446
1455..1494, 1592..1632, 3120..3254, 3442..3540, 4006..4197, 4366..4410
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved