Oryzias_latipes Locus DKC1
snOPY snoRNA Orthological Gene Database
Oryzias_latipes DKC1
Oryzias_latipes
DKC1
scaffold956
SNORD83
4291..4367
6739
GAAGTTCGGGAAATAACCTTCTTATTTTATAAGTCTTATTCCTTTTCTGAGAGTTTGTC
AGTGCCCGAGACTCTGGATGAATAAAGAGCCTAAACCCTGGTTAACTAGTTTTTCGGTAA
TCCCAATACATGAGAGGAAATCCAAAAGCTCTCTAGCCCCGCCCCGGATGTGGCTCGATC
GTCTTCCGGTGCTCGTAGACCAAAGAATAAGAAGGCGGACGCTCGCACGCAGTCACTTGG
AAGAAGATGGCGGAGGTTGAAGGTAAGGGCGACCCACGTGGTTCTGAAGTTTTGCCAGAA
TCAGAACCGCTACCCTTAATGCAAAATCAACACGCCCGCACGGCGTTACTGACGCAGTTC
CCATCGCACGCGCGGCGCGTTCTGCAGAGCAGGCCGCGCACCAAAGCAGGCCGAACCGCG
CCACGTGCGTCCTGCTCCGGGCGGCCTACACGATAAACCGGGTCAGATTCGGTTCGCTTT
TGGAGGTCTGCTACTTCAGGGGTTGAGCGCTTCTTTGGATTCCCGCCCCGCGTGGTCCTT
CCAGTCCACGTGACGTGCAGGAAACGCCACGTGCGTTGGGAATAAGTCGTTAGTTTTTAA
CAAACACCTGTTTGATTCAAATGTGCGCGCGCCACAATCAAAATGGGAAACACAATTAGG
TTCTGACTAGTTTATTATATGACAGTTTTTGGGTCGAACGGATCAGAGCCGAACTGCAGT
AAAACGTGGCTCCGTTTCATGTCTGCACCGGTTCTAACCGGTTTACGATCAGTGCAAACG
TTTCCACCTGCGGGGTCTCCAAAACGGTCAAAGATTTTGTTGATGATTCGAGACAAAAAT
CTACGAATTCAAGATTTTTAAGGATCCATTGAGATGACTTTAGCAGTAAAGCAGCCCCAA
AGCATGATGCTTCCACCCCCATGCTTCACAGTAGGTAAATGGTGTTCTTAGGACGCCACT
CCACTAATCTGCTGTTCCGTGTTTCTGCAGTAGCATCTGTTAAAAAGAAGAAAGGGAAGA
AAGTCTGCGATGAAGAAGTTGGGGTGAGTGATGTTGTCTGGAGTAAAGGTAATCTCATGG
ATCTGCTGGAGCTGACTGTTTGTTTTCCAGGAGATCCAGAGGAGTGCTGACTTTTTCATC
CAGCCAGAGTCCAAGGCAACATCTTTAAACACATCACAATGGCCCCTCCTTCTCAAGGTC
AGCTCCACCTCGACCCCTGCCTGGGTCATGTGACATGTTGGCAATGTTGGTGTGACATGA
TGAAGCAGTTTATCCATTCTCTGAGCACTGCAGTCTTGGCGTTTCTTTGCCCGTCTCCAT
CTTTGGGGCCTGGTCTCTGCTGGTCACCAACTGTGACCTGGCGTTCTGCCAGGTTATAGG
AGGTGACCGTGTAGAGGTGGAAGCGACCAGACTGTTGTCAAGATGATGCTCTGCTCTGAT
CACACGCCGCCTTGAAACAGGAAATGTGTGAGCAAACAAAAAAATGGCTATGTGGTCCAG
GCTTCACTATCCGGCAGTGATTCAGATGGCTACTTTTTGGAGAGTATGTTACGAAAAAGT
AGTACCAGCATGGGGTCAAAGGGCATGAGAATATTTGGGCAACCTGGTACTGGGGTTGGT
TTCTCCCTTAGACAAAAAGCTAATTCAGGATTTAACGCCAGGTGTTCGCTTCGGTTGGTA
CATCGACCTCAAACTGTTTCCTGTTTTGGCAGAACTTCGATAAGCTGAATGTGCGGACGG
GCCACTACACTCCCCTGCCCAACGGCAGCAACCCCCTGAAGAGGAACATTGCAGATTACG
TCAGGTACATTCACGTTGCGTAGGGTCAATGCTATGACGCAGATTGCATAATGACACTGC
CTCCTCTACTTAAGGTCTGGCTTCATCAATTTGGACAAGCCAGCCAACCCATCATCCCAT
GAGGTGGTTGCGTGGATTCGTAGGATTCTGCGAGTGGAGAAAACTGGACACAGTGGGACG
CTGGATCCCAAGGTCACTGGCTGCCTGATTGTGTGTATAGACCGTGCCACACGATTGGTC
AAATCGCAGCAGAGTGCAGGTACGGGTCCTGAGGGTGTCTGGCTGGGTTTTGGGCTTCAG
GTCTGATTGGCAGATTACAATCACTAAGACCTGAGAGGGGATGGGTCTGATCCAGAACTA
GAGCTGAGGATCCAAAGGCTTTTCTACTCTTCATTCTCTTCAATGTCCCCCTCCACTTCA
TCCGTACTGATCTAAACCAGACCCCCACAAATCTGTTTCTATTTAGTTTTTGCTTTATCT
AAAACTGTGAATTTTAGTCCAGACAATGAAGATGGAAAAGGACACTCTAGCTTTAATAAA
TGAAAAGACAAAAAACGGATACTGATGATCCGAAATCAAACCTTTTGCTGATGCTTTAGT
AACGCATATGGAAGCACGGGGGTCATTTCAGCAGCAGGCCATCTCTGACCGCCCTGGTCC
ACGTCAGGACGTTTGCTGAATATTTTTGTGCGCGCACACCTGGCTGCTGCAGTCAGCTGG
CCTGACGTCTGTCTTTGCAGACACCATGTGACCATGGGTCCGCTACAGAGTCAAAGTACA
AGGATCTGCTTCTGTCACCGGGCGATCCTCAGTCTGCCAGCACTGTGTGATTGGCCCACT
TCACCTAAGCACTGGTTCCTTTAGCTGCGAGCCATTTGGGAGCCGTTGATTGGTTGAAGC
CTGACTGTTCTGTGTTGCAGGTAAAGAGTATGTGGGGATCGTCCGGTTGCACAATGCAGT
GGAGAACCAGCACGCTCTGGCCCGGGTAAGTCTGACCTGATGATCCAGTAAGAGCTTGCC
TTAAGCACACACGGCTGAGGCTTGAGGTTCTGGAAGGTCTTGCATTTAAACCCTCCAGAG
TAAAATCCTATTTCAATTCTTTTTTTTTTTATTGCAAACAAAAAGAGAATTGTTACATAC
ATGAAATACAATGAAACAAAGAAGTGGTTTCATTTTGTGCACGGAGCCTCTTTGTATTGA
AAACTGAAGGTTGCAGACATGAATGTGGGTCATTTAATCAGGAACAACATATTCTTGTGT
AATCAGAACATTTCAGGTCATTGTTTTCTTTCTGAAATATGGAACTGAGACAATAATATG
GTGATAATGGCGTGTAAGCAAATGATAATGACGTAAACCCTAACATTACTCCCTTTTTAT
CATTTGATGTATTTTAGGCACTGGAAACGCTTACAGGAGCCTTATTCCAGCGGCCGCCAC
TGATCGCTGCTGTGAAGCGCCAGCTTAGAGTCCGGACCATCTATGAGAGCAAACTGATAG
AGTATGACCCGGAACGAAGGCTGGGTAAGAACCCGGCACTGCCACTTTGTATATTAGGCT
CCATCCGTCACTTTGATGGTTGTGATGAAACTCACCTGGACAGGTGATAAAGTAGACCTT
GGAACCTCCTGGGACTTAAGTTTATCAGCTTGAGAACTTCAGATTTAGTACCTGGAGCGT
TTGCTGTTCACAAACAGGACCCACCAAGCCCCCCAGTGCTGGTTCCTGCGGCTGCTTTAG
GAGTTGGAAGTTCAGTCGCTGATGTGTGGTGACGGCCGTGCTTTGCTGTTGTGTTGCAGG
CATCTTCTGGGTGAGCTGTGAAGCAGGAACATACATCCGGACTCTGTGTGTGCACCTGGG
GCTGCTCCTCGGCGTTGGCGGTCAGATGCAGGAGCTGAGGAGAGTCCGATCTGGCGTTTT
GGGGGAGAAGGTCAGCCCTGTTACCTGTTGGTGTGAAGTCACCTGTCCAGAGTGTTGAGT
GCAGCTCTGCTGCTTGGTGCAGACCTGAAAATTAGACTCTGGAACATTAACGGCAGCTGA
GAATCTGAAGTGCGGTGTGTGTCCAAACTACGGAGTCTTTCTTCTGCCACATCTGCGCTG
AGGGCTTGTGTTCTTCCAGGACAACATGGTAACCATGCACGACGTTCTAGACGCGCAGTG
GCAGTTTGACCACAACAAGGACGAGACGTACCTGCGAAGGGTCATTTTCCCCCTGGAGAA
GCTGCTGGTGTCGCACCGGCGGCTGGTGATGAAGGACAGTTCGGTGAGTCTTCCTGGAAG
GTTTTCAGTGCATTGAGGCGGTGCAGTGTGGTCTGATGCAACACAACTTTGTAGGTCAAC
GCCATCTGTTATGGAGCAAAAATCATGCTGCCAGGTGTGCTCAGGTATGAAGACGGCATC
GAGGTTAACCAGGACATTGTTGTCATAACAACCAAAGGAGAAGCCATTTGCACAGGTGAG
GTTTGTGAAGGACATGTACAGGTGTGTCCAGGCCACATGATGACTAGAGAAGCTGCAGCA
GCCTTCGGGCCGTGGCGACCTTTTATCTATCACCCTTGTCTGATGGCCTGTCGGTCCAAA
CGTTCGATTCCTGGATAAAGCAGACATAAGTGACAAATGCTTTCTGCTCTCCAGCTGTTG
CCCTGATGACCACGGCCGTCATCTCCACATGTGACCACGGCTTTGTGGCAAAGATCAAAA
GGGTGATCATGGAGCGGGACACTTATCCTCGGAAGTGGGGTCTGGGCCCAAAGGTATGAC
ACTTCCTGCTTTTACATGCTGGTTCTTGGATTATTAAGTTGTGGTTGAGACCAACCAACC
TGTTTCTGGTTAGGCGACTCAGAAGAAGGCGATGATTCAAAAGGGTCTCCTGGACAAACA
TGGAAAGCCCAACGGCAGCACGCCACAGGACTGGAAAGAGCACTATGTGGACTACAGGTA
TGGCGGTGGGCGGAGCAGTCCGTCTGACCTGCAGACAGTTATCCCTCTCTGAGCTGCCGT
GCTCCTGGAGGGAGTCGCTCTGCTACAGAAACTCTCAGTTGGAGCTTCTTCCAGCACTGG
TGTCATGAAGCCCACCTGAGGACATTACTGTGTTGATCACCTGCCAAACTAACAGAGTTC
TGTTTCCACAGCGTCTCAGTGGCAGCAGCAGAAGCTCCTGACTCTTCAGTGAAGGTAAAA
GATCTGCTTCTAAAGGTCACCTGCTCCAGTTCGGCTTTAAACTTTCCAATTTGACTTAAT
TTGTCAGTTTTTGCTGAATAAACTTTTCCCATAAAAGTTGGATTTTGGTTCCAAGGGATT
TATTTAGAATATCTTATTTTATATGCAGCGAAGTGTTTTTTCTGTGGAACATGATGCAGG
AACTCTATAAACCTGGGTTCTGTTCTGCATGAAGTCCACGTGAAAGGAAGCGAATGTGGC
TTGAAGCAGCCTTTTGTGTTCCAGAGGAAAAGGGAGGCATCAGGCAGTGATGGCGAAGCG
GCGCCCACGAGCGCGTCCCCAGAGGAGATGAAGAAAGAAAAGAAGAAAAAGAAAAAGGAG
AAGCGGTCCAGAATGGAGGAGGCGGAGCCACAGGAGACGGACACAGTGCAAGATCAGGTC
TGTAATAAACGAGGGAACACAATGGGCTGGACCATCCAGAAGCTCTGAACAGTCTCCTTT
CCTACAGGTCACAGAAAGTGCCAAGAAAAAAAAAAAGAAGAAACGAGAAGAACCTGGCTC
GGAGTGATGATGTCATAAACGGGCTTGTCCGAACTTCTAATGGGCCTCAGCAGTCTGTGG
CGGTGTCATGGCGTCTGTGGGGATGGCGTGTTTTGTGCCTGCAGAAACGACCTCATGCTG
ACAACATTCAGAAGCAGAAGAGTTTTTGTATAGAAGTGATCAAATTCTTGTGTAAATATT
TTACTTTTTTATGGCAAAATAAAATAAATTTTCTGTTTGGAACTGAACAGTTAATGGTGC
ACTGGTGAGCCAAAAAAAAGATCTGTGGTCTGCCGTAACCCTGGATTACAAGAAAATGGG
TTAGATGGAACACTAGGGGTTGGTAGCCACATTTTTTGTATCTTCAACACAAATGTATTC
ATGTTGATTTAAAGAAAAAGGGTACTTTTCAATACGAGGCAAGAAGGGGGGGCAGGTGCT
GAAGTATGTACCCGACGGGCATGAACCCGTTTTGTTTCTGATAGTTTTTAGGTCAATTTG
TAACAACCTCGGTATGGATGAGTTTGGCTGATAAAGTCACTGAATGTGGATTTCAGTGAA
AGGTCAGACGAGGTAGAAGCAGGGAGAGAGAGGAAGGTACTGTCCCACCAAAAACTGATT
GATGGAAACTAAGGAGACAAACGCTGAAAGAGAAGAAGCAGTGATGCAGTGAAAGCCCAC
AGAGAGGAAACAGCTGGTCAGGAGATGGAACCAGTGAGAGGCCATGCCCAAAACCACCTG
GACTAACTGACCCCCCCCAAGTCATGCAATTTCACATACAACAATGTCTAAGTGAAATCA
CACTGAGGGATGTCCTCCCTGCTGTTAATTCCTTGAGGAAATGACACCAATCCAGACGTT
CAGATGATGCAGTTATCACTGAAAACATCAGCTTGGTTCTGGTCCTCTGTCTTGATGAGC
TGTCCAATCTTTGAGGCGACTGCAACCACAACTGATGCACTGCAGCAGTAAAATGTAGAC
TTAGCAGCAGCATCTAACAATGTAGGGTTAGTGCTCCACGTGCCCCTTTTTAAGATTCAG
TACCTGACCTGCCAAAGATCCGAACGTCCCTGTTGTGCAGCTCATTTCTTTTCTGTAATG
TGTTCATCCGTCCACATGAGGGCGCTGTCTAGGTCATACTCGAGGCCAAGCCAAATCCGT
TTGTAATTAATGTCAGATCTGAGGACAGCTGCGGTCCAGCGTTGAGGTAGGACGTTTCGC
TTTTTTGTTTAGATCAGAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1042, 1110..1196, 1712..1803, 1874..2058, 2720..2784, 3197..3323, 3599..3729, 3919..4062, 4134..4254, 4434..4552, 4633..4756, 5239..5396, 5467..5739
1001..1042, 1110..1196, 1712..1803, 1874..2058, 2720..2784, 3197..3323, 3599..3729, 3919..4062, 4134..4254, 4434..4552, 4633..4756, 5239..5396, 5467..5523
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved