Oryzias_latipes Locus RPS11
snOPY snoRNA Orthological Gene Database
Oryzias_latipes RPS11
Oryzias_latipes
RPS11
8
SNORD35
1553..1636
4057
TGACATTTACCAGCGACCATTGAAATCACGATCACCTTAACCAAGTTCAATGATAAGAG
AAACTCAGGCGTGAAGTCTACTTACTTCTTCAGCAACTTGGTGCCCACATCCAGTAGCTC
TTTGGATTTTTCTGAAAGACAAACATCCAGATTCCTGCTTTTTTCACGTTTTATACAGTA
TCTTAAAGTTGTTGAACCCACATTTAAAGAAACAACAAAACACTAATATGTCCAACACAA
AACGAAAAAGAAACCAATAACTCGAGTCGACGTGATGATCGTGTTTAGTGTGTAGCCAGG
TCACCTTTTTTAACAGTTTTAGCCAAAACTATTTTAATAAAAGACCATCAGCGCGTCACC
TTTGTCTTCGCTCTTGTTTAAAAACTTAAAAAAACAACAAGCTATTTCGGCTAGCATCTC
TATGCTAACTACATCGGTTTATATAAACTCCATCGAGATAAACTACGAACTTATAATTAT
TATAAGATCCCGTTTTTTAAAATTTATTTTAGCCCAATAATCGAGAATGTCATTGCCACC
ATTATTTTTAAATAATTAAATCGATGCTAACCGCTACCTTGATCGCCTCCTCCGGGGTGC
GATGCCATCTTGTTGCTTTATGGTGATCGGCTTCTACTTCCGTGAAATCACGTGTTGGGT
CAATTTTAATTTGAGTAACCCCTCCCCGGAGTCGTCATGCAGTCGCCGTTACTGGCATTT
GATAAACATCTAACACCAGGGGCGCTACTGCATCATCTAGATGTTGTGAGATCTTTAACC
AGTTGGAATGTTTAGAGCAAAGTGGGGGCTTTTAGTGTTTAAATAAATGAACAATAAATG
AATTAAAATATTTAAATAGTACTGGGCGTGTTTATTCGATAAGACAATTATAAAGAAAAA
AAACGAGAAATGCTCATTTGAAACGTCATTTCCTGTTTCAAACAGATTTTCCGCCCATCG
CGCGCATGCTCAGGTCTCTTTACGACTCGGCTGGCAAATATGGCGGATGCGCAAGTACGT
GGAACGTGGCGGATTTTTAAGAAAAATGATTATTTAGACGCACATACAAGCCAGTTAGAG
TCATTATATCGATACATTAAGAGCTTAGATATATTACTAAACAATTTCAGGCCAAGTTCA
TGCCCTTTTTGCCCATTATTTTTTTAGGTTGCCATCCTATCAACCTCGTGTAGCGTCGAA
ATGCTAATGCTAACGCGAATAGCTTAGCGTAGTTCTGGTTTACGCTACAGTTAAGTTTTG
TTAGTCTTACACATATGCATAGTCTCGCAAGGTAGTTAAACTATATTGTGGGGACTACTA
TAGTTGATCATTGATGCTCAATGTTTGTGTTTTATCTAGACCGAGAGGTCCTATCAGAAG
CAGCCCACCATCTTCCAGAACAAGAAGCGTGTTCTGCTTACCGATGGTGGGAAGGAAGGC
AAGGAGAAGCTACCCCGCTACCATAAAAGCGTCGGGCTTGGCTTCAAAACCCCAAGAGAT
GTGAGATAAATGAACGAAAACCCACTCTTAACTGTCTAGACATCTGTTTAGCCTGCAAAT
GATGTTTCTTCTCACGATGGTCTTCCAAGCCTTCAGGTTCTGACGACAACGCCTTTTGGC
AGAACTGATGCAGAGAAAAAAAATGCTGCTTTTAGTCAATGTTTCTGCTATGTGATGCCT
GAATTAGAACCCTAATTGAAATATTTTTATTTTTCTTTGTCAGGCTATTGAAGGCACTTA
CATTGACAAGAAATGCCCCTTCACTGGAAATGTCTCCATCCGTGGCCGTATCCTCTCTGG
TAAACATTTTGTTCAGTTGTGTTTTGAATTGTTACACCCTTTGTTGTCGTTTAAGCATTG
ATTAAACAATAGAATAAAAATAAACAGAGGTTGGGTTTGGTGAAGTTTGAACGCTGTTGT
CACTGTTGCACACATGATGCTTTTTCTCACGATGGTCTTCCGAACTCATGCAGTTTTGAC
GACACTGCCTAATGGCAACACTGATGTAGCCACGTGACAAAAGTGTAACCAACACTTCCA
ACAAATGGTTCGCTGTTGCATTCATTGTGCTGACGGTTTCTCTGTGTGTGTGAAGGTGTG
GTGACCAAAATGAAGATGCAGAGAACCATCGTCATCAGACGCGACTACCTGCATTACATC
CGCAAATACAACCGCTTTGAAAAAAGGCACAAGAACCTCTCTGTCCATCTGTCACCTTGC
TTCAGGTACTTTGCTACCCAATTTTTGAGATGAGGATTGAACGGATGTCTATAGGTAGTT
CTTTGAATTGTGCAGGATTTTAGTATATTTAAGCAAAGTTTCTAATGCTTTTATACTAGA
TTAGAATTGTGAAAGTTTCCTTAGAAATAAATATTTGACTTAAATTTTTGTTTTATTGTT
GCTGAATATCGATGTTGGTGTTTTAATGCCGTAATATATGTATATATATTACGTACGGAC
GTAAAGTCCCCCCCCCCACCAAATTCAAATTGATTCATTTTAACATTTCACTTTTTTTTG
TCAAAATATTAATGTTTTTAGGAAACAAAAATAAAATGTATTGACCCACTGACACCTGAA
TTTATTTTTCAGCTATGAAAAAAAAACCTTTATATTTAAATCAAGAGGTCATTTGAAACT
TAAACTTTTAAAAAATGCACATATGTAGTTTGTGCTTAAGAAAAATAACTTTCTAGAAGT
CAATTTCAAAGCATAAATATGCTGCAAATGCCATGAGTAGTTCTGAGGAAGGTGCCTTTA
GCAAACGCTGATGCAGCTGTGCCTCATCCTTTAACTGGACAAATGTTTGGTTTAGGGCTG
TTCTGTTCCTGCATCCTTTAACGTTTAGATGACCGTCTCTCTGCAGAGACGTCACCGTTG
GAGACATCGTGACCGTTGGAGAGTGCCGACCGCTCAGCAAAACTGTGAGGTTTAACGTCC
TCAAAGTGACTAAGGCTGCTGGAGCGAAGAAACAGTTCCAGAAATTTTAGGTTTGATTTG
GAGCAGGACGGCTGCTGGATAACACGACCCTTTCAAATAAAGAAAATCCTGTTTGAAATT
GTTTTGTGGTGTTTGTCAGTTTCACCAAATCCTGTTGTTCAGAAAGTTTTGTTTTTCTAA
TTTGATTAGAGATCATTGGCTGCTCGGTGGAGCATTGGTTGGCGCTCTTCCCTCACAGCA
ACAAGGCCGCTGGTTCAAGTTGCTTCACTGTAAAACTTTAATGTGTTTTTCATTTGAAAT
TTGGATAGCAACATCAAAACCCCAAGAGAGGTGAGATAAATGAACCACACCCTGCTCTAA
TATAAACTTTGAGATCTGTTTGTAGCCTGCAAATGATGTTTTTCTCACGATGGTCTTCCA
AGCCTTCGGGTTCTGACGACATCGCCTTTTGGCAAAACTGATGCAGGAAAATAAAAAGTT
TAGTCAATGCTTCAATGTGAAGCCTGCAATAGAACCCTTGATGTATGTAATTTTTTTGTG
GTGCAGTTCTTGCCTCAGCAATAATTCTGGTTCAAGTTCCGGCTGGGCACCTGAAACAAA
GTCAGTGGGGGGCCTTTCCGTGTGGACTTTGCATGTGTGCACGTGTGGGTCAGTCAGTGG
TCCCCATCTGTTTTAGCACCACGGACCGGTTTATTTTTTTTTCAATCTTTATTACACAAT
TTTCTATTTTATGAACCGGCCTTTAAGATGTTGGCGGAGGATTACTGTAGCAACGCCACT
TCAGAGGAGGAACAGATACGTGACAACACTAACCCCGAAATTTGACACGCATGGATAGAA
CATCGCAGGTGTCGTCATCCTCCCCCCCCTTCCAACGCTCATGGTGCAAAAAGGAAGTAC
TGTCTATAAAATGTAGCTTTCTTTTTTTGGAAGTGGAAGGCTCCTCCTTTGTCTCCTGGC
TGGGCGTTTTCCCTTTGGCAAAGAAACTTTCCAAAGACGTTTGTTTTTACTCATTTTGCT
AGCTCCTGGGTTTTATTTTAGTGGTAGCCTATCACGTGACTGAGAAGAGCGCCTTGGCCT
TCGTTAATGGTGACGAAGACCGATGTGACAGAGAATGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1248, 1359..1499, 1723..1798, 2095..2224, 2866..3057
1222..1248, 1359..1499, 1723..1798, 2095..2224, 2866..2986
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved